Labshake search
Citations for New England Biolabs :
651 - 700 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Eluted protein was detected via Bradford assay and immediately applied to a 1 mL amylose column at 4°C (New England Biolabs) at 10-15 ml/hr that was pre-equilibrated with nickel elution buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... comprising 6 mM 5’ cap analog (New England Biolabs), 7.5 mM adenosine triphosphate and 1.5 mM guanosine triphosphate (USB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Genomics 2024Quote: ... Small RNA sequencing libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina following the manufacturer’s recommendations with the 3’ ligation step changed to 16°C for 18 hours to improve capture of methylated small RNAs (New England Biolabs, cat# E7300S). Small RNA PCR amplicons were size selected on 10% polyacrylamide non-denaturing gels ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 U of T4 DNA polymerase (NEB), 13.5 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µL RNase H (New England Biolabs), 644 µL buffer A and 2 µL DTT (1M) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4 U murine RNase inhibitor (NEB). TMAO was adjusted to pH 7.5 in a 6 M stock solution with HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 µL 10X CutSmart Buffer (NEB) in a 40 µL reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10X T4 Ligase Buffer (NEB, Cat #B0202S ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 µL 10x T4 ligase buffer (NEB), and water to 40 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were treated with 5′ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3′ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Biochemistry 2024Quote: The library was prepared following our previously reported procedure with slight changes.[21] 3′-End repair and 5′-phosphorylation were conducted with T4 polynucleotide kinase (PNK) (NEB, M0201S). 16 µL RNA was mixed with 2 µL 10× T4 PNK reaction buffer and 1 µL T4 PNK ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Small RNAs were treated with 5’ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3’ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... ChIP–seq libraries were prepared from 3–5 ng of ChIPed DNA using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The aliquots were then divided into 3 digest reactions of 5 M cells and digested with the NlaIII restriction enzyme (NEB, R0125L). After subsequent proximity ligation and DNA extraction ...
-
bioRxiv - Cell Biology 2024Quote: ... were then ligated to pre-annealed Nano-tRNAseq 5’ and 3’ RNA adapters at room temperature for 2 hours with 20% PEG PEG 8000 (NEB, B10048) using recombinant E ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...