Labshake search
Citations for New England Biolabs :
651 - 700 of 4372 citations for 1 Bromo 3 difluoromethoxy benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Equal number (3×106) of cells were harvested in ice-cold nuclear extraction buffer (NEB) (400 μl ...
-
bioRxiv - Microbiology 2023Quote: ... The vigR 3’ UTR sequence was amplified from JKD6009 using Phusion Hot Start Polymerase (NEB) with primers incorporating the MS2 aptamer sequence (fused to 5’ end of vigR 3’ UTR ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: The biotin-enriched eluate was next subjected to 3’end dephosphorylation using PNK (M0201L, NEB) and FastAP (EF0654 ...
-
bioRxiv - Immunology 2024Quote: ... and 0.8U/µL of Klenow Fragment (3’-5’ exo-) DNA polymerase (NEB, Cat No. M0212M). Nickase induced linear SDA was performed using 3nM (0.04U/ µL ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 fragments were assembled using Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB). To re-introduce the proBA operon (now with A319G ...
-
bioRxiv - Genomics 2024Quote: ... the 3’ end of RNA fragments was dephosphorylated with FastAP (Thermo) and T4 PNK (NEB), followed by 5’ end phosphorylation of cleaved target RNAs with T4 polynucleotide kinase (PNK ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2,000 nM Rad51 were incubated with 3 μM nt ϕX174 ssDNA (5,386 nt; NEB) in buffer containing 2 mM nucleotide (where indicated) ...
-
bioRxiv - Neuroscience 2024Quote: The 3 DNA fragments were fused using the Gibson Assembly Cloning kit (New England Biolabs) and subcloned into the pCR2.1-TOPO vector (Invitrogen) ...
-
bioRxiv - Genomics 2024Quote: ... to 3’-P presenting in the RNA that was dephosphorylated using T4 PNK (NEB, #M0201S). Linker and RNA ligation was performed by ligating pre-adenylated linker to the 3’-OH of RNA using RNA ligase2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... custom NTP mix was prepared with 3’-O-Me-m7G cap analogue (60 mM, NEB), GTP (75mM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Physiology 2021Quote: ... RNA 3’ end dephosphorylation reaction consisted of T4 PNK (20 U/10 μL sample, NEB M0201S), SuperaseIn in 1X T4 PNK buffer without ATP for 60 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA from A549 cells (3 µg in 30 µl) was treated with RppH (NEB M0356) at 30 °C for 1 hr and purified by spin column ...
-
bioRxiv - Genomics 2020Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biophysics 2021Quote: Purified plasmids were digested at the 3’ end of the insert sequence with EcoRI-HF (NEB) to linearize the template with a 5’ overhang for in vitro transcription ...
-
bioRxiv - Genomics 2022Quote: ... 3 ug of input DNA was dephosphorylated with Quick CIP (New England Biolabs, cat no M0508). Following enzyme inactivation with alkaline phosphatase ...
-
bioRxiv - Bioengineering 2022Quote: ... NU-1707L) was added to the probes’ 3’ ends with Terminal Transferase (New England Biolabs, M0315L), which adds a single azido-dATP molecule ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ribosome footprints were generated by incubating the lysate with 3 U/µg of micrococcal nuclease (NEB) for 40 min at 25° C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... rinsed with PBS and incubated in PBS containing 3% molecular biology grade BSA (New England Biolabs) and 0.05% Tween-20 for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the piggy-bac vector pPBhCMV1-miR(BsgI)-pA-3 was digested with BsgI (#R05559S, NEB) and the digested vector excised from a DNA agarose gel and the DNA purified ...
-
bioRxiv - Genomics 2021Quote: ... dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: ... followed by an overnight incubation at 16°C with 3 µL T4 DNA ligase (NEB, M0202). Samples were purified with phenol-chloroform and used as 3C templates for Taqman-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... Concentrated medium was collected from the filters and 3 μl of PNGase F (New England Biolabs) was added to each sample then incubated at 37 °C for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... media was replaced with media containing 3 µM SNAP-Cell block (New England BioLabs cat. # S9106S) and cells maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3′ dA-tailed using NEBNext® Ultra™ II End Repair/dA-Tailing Module (NEB E7546L) and were purified with paramagnetic beads ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... then dATP was added to the 3′ ends of the DNA using Klenow exo-(NEB #M0212). The DNA was then subjected to double-sided SPRI bead size selection (AMPure XP beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs), and (3 ...
-
bioRxiv - Bioengineering 2024Quote: ... The extracted DNA (3 μg) was fully digested with NcoI restriction enzyme (New England Biolabs, USA), separated in a 0.8% agarose gel and blotted onto a Hybond+ Nylon membrane (Amersham Biosciences) ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI ...
-
bioRxiv - Cell Biology 2024Quote: ... newly deposited CENP-A was labelled with 3 µM SNAP-Cell® 647-siR (S910102S, NEB) for 30 mins before washing excess with media and allowing to grow for a further 30 mins ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... and a NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) (Code E7710; New England Biolabs) according to the manufacturer’s instructions ...