Labshake search
Citations for New England Biolabs :
651 - 700 of 7064 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 1:50 (NEB, 14001), (5 ...
-
bioRxiv - Genetics 2020Quote: ... 1:100 (NEB, 51255), (4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligase 1 (NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM ATP (NEB), 1×T4 DNA Ligase Buffer and 800 U T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 1× Buffer 2.1 (NEB), 2 µg BSA and 3 units of T4 DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Topoisomerase 1 (NEB), 0.1 mg/ml BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl MlyI (NEB). The digest was incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM NAD+ (NEB) and water to a volume of 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... 1 mM dNTPs (NEB), 1 U/μL RNase Inhibitor (NxGen ...
-
bioRxiv - Molecular Biology 2023Quote: ... pyogenes (1 μl, NEB), and 0.2 µl phenol red were mixed in an Eppendorf tube (total volume 2.2 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... after DNase 1 (NEB) treatment.
-
bioRxiv - Microbiology 2024Quote: ... 1 mM NAD+ (NEB), 4 µg of DNA or RNA oligo ...
-
bioRxiv - Genomics 2024Quote: ... 1% BSA (NEB, B9000S), and 1U/ml Protector RNase Inhibitor (between 100-200 μl depending on pellet volume) ...
-
bioRxiv - Genomics 2023Quote: ... 1 mM ATP (NEB), 4 mM DTT (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl RNaseOut (NEB), 2 μl of 100 μM TSO ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl DpnI (NEB) was added to the PCR mix ...
-
bioRxiv - Genomics 2023Quote: ... and 1× Thermopol (NEB) at 72°C for 60 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl ExoI (NEB) and incubated for 1 h at 37°C followed by heat inactivation of 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1-unit, NEB) was then added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1 unit, NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... apyrase (1 unit NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... with GlycoBuffer 1 (NEB) was added.
-
bioRxiv - Genomics 2024Quote: ... 1 μL NAD+ (NEB), 1 μL dNTP mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Immunology 2024Quote: ... 0.5 µl of 2 µM UPA-long and 0.25 µl Phusion Hot Start Flex DNA Polymerase (New England Biolabs) were added to 15.25 µl nuclease-free water ...
-
bioRxiv - Microbiology 2024Quote: ... Next, the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: The 9N_VRA3 adapter oligonucleotide (0139, Supplementary Table 2) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) using the following protocol ...
-
bioRxiv - Physiology 2024Quote: ... 5 flies were sorted into sterile microcentrifuge tubes and homogenised in 200 µl lysis buffer (1 X TE, 1 % Triton X-100, 1/100 proteinase K (NEB, P8107S)) using a mechanical pestle ...
-
bioRxiv - Bioengineering 2024Quote: ... and phosphorylated (1 μL 100 μM F oligo, 1 μL 100 μM R oligo, 1 μL T4 ligase buffer (NEB, B0202S), 1 μL T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 1:1 combination of oligodT 18 primers and random hexamers (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl 10× T4 PNK buffer and 1 μl T4 PNK enzyme (NEB) at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314) in the reaction buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of BsaI-HFv2 and 1 μl of T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was further adjusted with dTTP (1 µl, 1 mM) (NEB #N0443S), TdT reaction buffer (1 µl) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl of DNAse I at 1 mg/ml (NEB, cat no. M0303L), 1 μl RNAse at 10mg/ml (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... a 1 μL portion of a 1 mg/mL stock of trypsin (NEB Trypsin-ultraTM ...