Labshake search
Citations for New England Biolabs :
651 - 700 of 3754 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL T4 DNA Ligase Buffer (NEB), 0.5 µL T4 DNA Ligase (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of the appropriate buffer (NEB) and 0.125 µL of each restriction enzyme were combined in 10 µL total reaction volume ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 U/μL RNase Inhibitor (NEB) in Biotin Wash Buffer (10 mM Tris HCl pH 7.4 ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL of 10X T4 buffer (NEB), and 5 μL of nuclease-free water (Ambion ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL T4 ligase buffer (NEB, B0202S), 0.5 μL Esp3I (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 10 μL incubated at 37°C for 2 hours and 80°C for 1 hour) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1 μL Taq polymerase (NEB, M0267S) and incubation at 37°C for 20 min and 72°C for 5 min) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL T4 ligase buffer (NEB, B0202S), 0.5 μL Esp3I (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and with 1 µL PmeI (NEB #R0560). If plasmid concentration was not sufficient ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL T4 DNA Ligase Buffer (NEB), and water to 10 µL was incubated at 37°C for 1 hour ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1 U/µL murine RNAse inhibitor (NEB), 400 nM 11S NanoLuc protein (purified as described in25) ...
-
bioRxiv - Genomics 2022Quote: ... Chimeric RNA barcode molecules were eluted from the bead by incubating with 127 µL ProK digestion solution (11 µL ProK (NEB cat # P8107B),100 mM Tris pH 7.5 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... vectors were from Park and Kim.11 The AtADT2 sequence and pHyo182 backbone were PCR-amplified and Gibson-assembled (NEB, Ipswich, MA). The S222N mutant of AtADT212 was recreated by site-directed mutagenesis (Q5® Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... SCAR-seq libraries were prepared following the previous published protocol (11) without any modification except using NEBNext® Ultra™ II DNA library prep kit (NEB) for the end repair ...
-
bioRxiv - Genetics 2024Quote: ... is a modification of this plasmid with TADa for ABE base editing derived from [11] and cloned using Gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB Cat#E2621) and amplified using NEB 5-alpha F‘Iq Competent E ...
-
bioRxiv - Cancer Biology 2024Quote: ... was purchased from GeneCopia (EX-OL00093-LX304).The C-terminal 11 amino acids were deleted using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). Primers were designed using the NEBase Changer tool to generate the deletion were ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL Pr_P7 (10 µM; Supplementary Table 1) and 0.5 µL Vent (exo-) DNA Polymerase (NEB 2 U/µL). The PCR program comprised an initial denaturation step (95°C ...
-
bioRxiv - Genomics 2024Quote: ... was utilized using 1 µg gDNA and the pre-annealed NEB adapter (NEB_P7, NEB_P5, 15 µM; Supplementary Table 1). The manufacturer’s instruction was followed without performing the USER enzyme step ...
-
bioRxiv - Genomics 2024Quote: ... beads were resuspended in 1 ml binding buffer (as described above) including 1 μl of fusion enzyme Nt.CviPII-pGL (NEB) for 1 hr at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 8.0) for 1 h at 37 °C and washes in CSTX buffer (1× CutSmart buffer (New England Biolabs (NEB) B60004) ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 mM dNTPs (NEB #N0447L), 250 nM PAGE-purified forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 U Turbo DNase (NEB) and 3 U FastAP enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... Mammalian cell lines were handled under sterile conditions using a laminar flow hood and the cells were regularly tested for mycoplasma contamination with a PCR-based mycoplasma detection kit (Minerva-Biolabs, cat.no. 11-1250). Subcultivation was performed every 2-4 days at a confluence of maximum 80 % using trypsin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... magnetosome genes were PCR amplified from the G2-11 genome using the high-fidelity Q5® polymerase (New England Biolabs, New England USA) and cloned by restriction sites into the pBamII-Tc vector (Supplementary Table S4) ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...