Labshake search
Citations for New England Biolabs :
651 - 700 of 7444 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... From AF293 genomic DNA we amplified a ~4 kb fragment that included ~1kb 5’ and ~200 bp 3’ of sskA and introduced PacI and NotI (New England Biolabs) restriction sites at the 5’ and 3’ ends ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Flanking primers contain 20 bp of 5’ and 3’ overlap with the pcDNA3.1 vector for Gibson Assembly (New England Biolabs, #E5510). The resulting library had an estimated complexity of 322 = 1024 codon variants and 202 = 400 amino acid variants ...
-
bioRxiv - Genomics 2020Quote: ... The pbp2x 5’-end and 3’-end amplicons were spliced with the linearized pBBL740 amplicon using NEBuilder HiFi kit (New England Biolabs). The resultant spliced plasmid was transformed into parental strain MGAS27213-L601P and single cross-over transformants were selected by plating on THY agar with chloramphenicol 10ug/ml ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Molecular Biology 2022Quote: ... were annealed to an oligonucleotide containing the antisense of the 3’ restriction site (5’-GGT TGA TTA TCG ATA AGC TT-3’) and extended using Klenow Polymerase devoid of exonuclease activity (NEB). Resulted fragments were inserted into the pAAV-CAG-hFXN plasmid between the stop codon of the hFXN and poly A signal ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB). The resulting fragments were ligated to Nextflex adapters (Bio Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ pir-2 flank::PtrpC::nat::3’ pir-2 flank assembly was constructed using NEBuilder Assembly Kit (New England Biolabs). Each assembly fragment was either synthesized (T4 Oligo ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Biochemistry 2024Quote: ... either at the 5’ or 3’ of the trimerization domain and then inserted into a pET29b+ vector using PaqCI (NEB). Briefly ...
-
bioRxiv - Genomics 2024Quote: ... the samples were amplified in a total of 11 cycles using Phusion Polymerase (NEB, M0530S) in 1x HF buffer ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Immunology 2024Quote: ... using BsmBI (New England Biolabs, supporting table I-b). The plasmid containing the gRNA targeting mSppl3 or mUgcg (lentiCRISPR-v2-mSppl3gRNA-GFP or lentiCRISPR-v2-mUgcggRNA-GFP ...
-
bioRxiv - Genomics 2024Quote: ... (b) PURExpress T7 recombinant IVT system (NEB Cat.#E6800L), for inserts in pTH6838 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’-end of dephosphorylated mRNAs were then labeled using 10 units of T4 PNK (NEB) and 0.5 µl [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... We incubated 10 pmol gRNA with 5 pmol SauCas9 (New England Biolabs [NEB], Ipswich, MA, USA) at 25 °C for 10 min ...