Labshake search
Citations for New England Biolabs :
6901 - 6950 of 9360 citations for Rat CD325 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and the library preparation was conducted using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed on the NextSeq500 machine (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from agar plate-grown seedlings by acid guanidinium thiocyanate-phenol-chloroform-based extraction and purified from the aqueous phase using the Monarch RNA Clean Up Kit (New England Biolabs, Ipswich, MA, USA; NEB). Genomic DNA in the samples was removed using TURBO™ DNase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... each genomic segment was amplified as two PCR products and cloned in the pDIVA backbone (Wetzel et al., 2018) using the NEBuilder HiFi DNA Assembly kit (NEB). The CP-RT ORF (without viral UTRs ...
-
bioRxiv - Neuroscience 2024Quote: ... were generated from a pENTR cyfip2-EGFP plasmid [32] using custom primers and the Q5 Site Directed Mutagenesis Kit (NEB) to induce the desired C179R (ΔRac1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Silent mutations were introduced at the PAM site of the HDR vector by using the Q5 site-directed mutagenesis kit (New England Biolabs). The APEX2-V5-Ten-m HDR and the Ten-m gRNA vectors were co-injected into vas-Cas9124 fly embryos by BestGene ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were generated using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, #E7645L) according to the manufacturer’s instructions and PCR amplified ...
-
bioRxiv - Immunology 2024Quote: ... Oxford Genomics Centre prepared bulk RNA libraries using an NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced the samples at a depth of 25 million reads per sample on a NovaSeq6000 (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 500ng RNA using a Multiscribe High Capacity cDNA Synthesis kit (Thermo) and qPCR was performed using Luna qPCR Master Mix (New England Biolabs) against primers listed in table 2.
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Stored lenses were kept at either 4°C for up to one week or -20°C for up to one month before purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). We used approximately 30 lenses at 10 dpf ...
-
bioRxiv - Developmental Biology 2024Quote: ... Poly(A) mRNA library preparation was performed using NEBNext Ultra II DNA library prep kit for illumina (New England BioLabs) and 2x100bp paired-end sequencing was performed at a depth of 50 million reads on an Illumina Novaseq 6000 platform by the University of Toronto Donelly Sequencing Centre ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Cell Biology 2024Quote: ... the RNA underwent quantification and quality assessment before library preparation using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Immunology 2024Quote: ... pUC57-mini plasmids harboring the WT or mutated coding sequence downstream of T7 promoter were first transcribed into mRNA using the HiScribe T7 ARCA mRNA Kit (New England BioLabs) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Genetics 2024Quote: ... The DNA fragments were blunt-ended and ligated to the Illumina index using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England BioLabs). Libraries for next-generation sequencing were prepared and sequenced with a NovaSeq 6000 instrument (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA was extracted from heads and thorax+abdomen of one female and one male using the Monarch Total RNA Miniprep Kit (New England, BioLabs). RNA was purified by ethanol precipitation and equal concentration of head and thorax+abdomen tissue was pooled for sequencing ...
-
bioRxiv - Genomics 2024Quote: ... 400 ng genomic DNA of each sample was used to construct whole-genome DNA libraries with an NEBNext Ultra II FS DNA Library prep kit (NEB) and NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We generated a next-generation sequencing library using an NEB Ultra II DNA Library Prep kit (New England Biolabs, MA) with an Illumina-compatible y-adapter ...
-
bioRxiv - Developmental Biology 2023Quote: ... WGA DNA was subsequently processed for Illumina library sequencing preparation using TruSeq indexing of the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). NEBNext Multiplex Oligos for Illumina (96 index primers ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we multiplexed the different DNA extractions using the NebNext Ultra II FS Library Prep Kit (#E7805, #E6440 and #E6177; NEB). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR reaction was then used as a template for in vitro transcription using EnGen® sgRNA Synthesis Kit (NEB), and the MEGACLEAR Transcription Clean-Up KIT (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... and reverse-stranded sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Libraries were sequenced on an Illumina NovaSeq 6000 machine ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA libraries were constructed using the NEBNext Ultra II RNA Library prep for Illumina kit (New England Biolabs, MA, USA), NEBNext Poly(A ...
-
bioRxiv - Genomics 2024Quote: ... Library amplification (10-12 PCR cycles) was carried out using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs), with IDT for Illumina UD Indexes (96x ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by the conversion of the remaining RNA into an Illumina sequencing library using the NEBNext Ultra Directional RNA Library Prep kit (New England Biolabs). Following library preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genetics 2024Quote: ... RNA sequencing libraries were prepared with unique barcodes using the NEBNext Ultra RNA library kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... mRNA used for comparison in NAGE gels was produced using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
bioRxiv - Immunology 2024Quote: ... Template DNA digestion was carried out at 37 °C for 30 minutes in a thermocycler block prior to purification of the RNA using a Monarch RNA Cleanup Kit (New England Biolabs). Purified mRNA was eluted in DEPC-treated water and stored at -80 °C prior to use ...
-
bioRxiv - Genetics 2024Quote: In vitro transcription was carried out on a linear DNA template using the HighScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were then created from each fraction using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645L) and the Unique Dual Index NEBNext Multiplex Oligos for Illumina (NEB ...
-
Recurrent loss of crossover interference punctuates the recombination landscape across yeast speciesbioRxiv - Genomics 2024Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: Reporter gene fusions for cis-regulatory analysis were made using either PCR fusion or Gibson Assembly Cloning Kit (NEB #5510S) 88 ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared with 5ng of CUT&RUN DNA using NEBNext Ultra II DNA Library Prep Kit for Illumina (Cat # E7645S, NEB) following manufacturers protocol ...
-
bioRxiv - Immunology 2024Quote: VR therapy vectors and the CAR therapy vector were first designed through Gibson Assembly molecular cloning (HiFi DNA Assembly Cloning Kit, NEB) using the backbone pSLCAR-CD19-BBz (Addgene) ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries for Illumina sequencing were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer instructions ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs), multiplexed ...
-
bioRxiv - Genomics 2024Quote: Between 2 and 4 million cells were harvested by centrifugation and high molecular weight (HMW) genomic DNA was extracted using the Monarch High Molecular Weight DNA Extraction kit (NEB) and agitation speeds of 1,500 rpm.
-
bioRxiv - Immunology 2024Quote: ... The unpurified DNA product was then subjected to in vitro transcription using the NEB HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), incubating at 37 °C for 16 h ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed in a final volume of 100 μl using the PURExpress ΔRibosome In vitro Protein Synthesis Kit (New England Biolabs) according to the manufacturer instructions and with ribosomes purified from E ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids containing either rpsL-cat or the inducible promoter tetO1 [18] flanked by regions homologous to the DNA up- and downstream of the ggt-promoter were constructed using a commercially available Gibson Assembly Cloning Kit (NEB). Homologous regions were amplified from the genomic DNA of strain PMSS1 using primer pairs FlgK fwd/FlgK rev (rpsL/tetO1 ...
-
bioRxiv - Microbiology 2024Quote: Plasmid pET28bR109H for overexpression of the R109H mutant was obtained by site-directed mutagenesis of plasmid pET28bRho (kindly provided by Pr. James Berger, Johns Hopkins University) using the NEBuilder HiFi kit (New England Biolabs). The R109H mutant was overexpressed in BL21(DE3)pLysS cells carrying the pET28bR109H plasmid and purified as described for WT Rho 105.