Labshake search
Citations for New England Biolabs :
6901 - 6950 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Capped SAM was synthesized in vitro using HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) and purified using a RNeasy Maxi Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fragment was cloned into AscI-digested pBYL2 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were constructed with the NEBNext Ultra II Directional RNA Library Prep kit for Illumina (NEB, E7760), amplified with custom oligonucleotides ...
-
bioRxiv - Genomics 2019Quote: ... except that sequencing libraries were prepared using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB cat#E7370L) following manufacturer’s protocol and sequenced on Illumina Hi-Seq 4000 with 100bp paired-end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribosomal RNA was depleted from 200 μg of the RNA using the NEBNext rRNA Depletion Kit (NEB E6310X) and then a cDNA library was prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB E7530L) ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). For strand-specific RNA-sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: sRNA-seq libraries were prepared using the NEB Next Small RNA-sequencing kit (NEB #E7300, New England BioLabs), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: sRNA-seq libraries were prepared using the NEB Next Small RNA-sequencing kit (NEB #E7300, New England BioLabs), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... libraries for sequencing were prepared with the NEB Next Ultra II RNA Prep Kit (New England BioLabs, Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... the myc tag was removed from the Ccz1-myc plasmid using NEB site-directed mutagenesis (SDM) kit (NEB) following manufacturer’s instructions and primers selected using NEBaseChanger tool (table 1) ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing libraries were generated using a NEBNext® Ultra RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... The RNA-Seq libraries were prepared with NEBNext® UltraTM RNA Library Prep Kit for Illumina (E7530L, NEB) by following manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: ... Sample and input libraries were prepared using NEBNext Ultra II DNA Library Prep kit (New England BioLabs E7645) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: RNA-Seq libraries were generated using the NEBNext Ultra™ RNA Library Prep Kit for Illumina (NEB #E7530). Libraries were quantified using the NEBNext Quant Kit (NEB #E7630) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Illumina libraries were prepared using NEBNext DNA Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) following the manufacturers protocol ...
-
bioRxiv - Immunology 2022Quote: ... in vitro transcription of BNT162b2 mRNA was performed with a HiScribe T7 ARCA mRNA Kit with tailing (NEB) with 2.5 mM N1-Methylpseudouridine-5’-triphosphate nucleoside analog (TriLink BioTechnologies ...
-
bioRxiv - Microbiology 2022Quote: ... dsRNA was generated using the HiScribe T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs, Ipswich, Massachusetts), purified using the Monarch RNA Cleanup Kit (T2050S/L ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 µL of T7 polymerase (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, NEB, Ipswich, MA, USA), 20 U of RNase murine inhibitor (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Library preparation and sequencing was completed using NEBNext® Single Cell/Low Input RNA Library Prep Kit (NEB) and NextSeq 550 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... We noted an improvement of the Gibson assembly efficiency when gel-purifying DNA using the Monarch kit (NEB) compared to other kits ...
-
bioRxiv - Neuroscience 2022Quote: ... University of Cambridge) using the NEBuilder HiFi DNA Assembly kit based on the manufacturer’s instructions (New England Biolabs). Transgenic animals were validated by reverse transcription PCR targeting the correct insert ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were prepared with a NEBNext Ultra II DNA library preparation kit (NEB, Ipswitch, MA, USA) with 10 cycles of PCR amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... and used to prepare libraries with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) with 11 amplification cycles ...
-
bioRxiv - Genetics 2022Quote: ... RNA sequencing libraries were constructed using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA) following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770) following the manufacturer’s instructions ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Clones were screened and confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... All of the mutations were introduced using the Q5 site directed mutagenesis kit (New England Biolabs, Ipswich, MA) with primers listed (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2022Quote: ... and Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). Index codes were added to attribute sequences to each sample ...
-
bioRxiv - Bioengineering 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA), and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Genomics 2022Quote: ... The correct size band was cut and purified with the Monarch Gel Extraction Kit (New England BioLabs T1020L). The insert single-stranded DNA was diluted to 1 μM with H2O ...
-
bioRxiv - Developmental Biology 2022Quote: ... before DNA library preparation using the NEB Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and the sequencing libraries were synthesized using a NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). Sequencing was performed using a NextSeq 500 Sequencer (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs) size selection ...
-
bioRxiv - Genetics 2022Quote: ... The RNA was transcribed using 1ug of template with the HiScribe T7 Quick High Yield kit (NEB, E2050) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated using the NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA, USA) and subjected to sequencing (single-end 92× ...
-
bioRxiv - Genomics 2022Quote: ... Short-read sequencing libraries were constructed using NEBNext Ultra II DNA Library Prep kit for Illumina (NEB, USA) at the University of Melbourne ...
-
bioRxiv - Immunology 2022Quote: ... parkeri- infected ticks using the NEBNext Ultra™ RNA library Prep Kit (New England Biolabs, Ipswich, MA, USA). RNA library preparation and sequencing were conducted by Novogene Co. ...
-
bioRxiv - Genomics 2022Quote: ... 300 bp and 500 bp) were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) according to the standard protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The amplified fragment was cloned into pSEVA121 using the NEBuilder® HiFi DNA Assembly kit (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using the NEBNext Ultra RNA Library Prep Kit for Illumina (Cat No. 7530, New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded libraries were made with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75 bp reads ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, cat# E7103S) according to the manufacturer’s instructions with the following modification for bisulfite treatment ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries for sequencing were constructed using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB). The poly (A)-tailed mRNA was enriched using the NEB Next Poly (A ...
-
bioRxiv - Microbiology 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) with 1 μg of total RNAs ...
-
bioRxiv - Microbiology 2022Quote: ... and RNA-Seq libraries were generated using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Two biological replicates were sequenced using the Illumina NextSeq 550 platform to generate 150 bp PE reads ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesis was conducted via ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich MA, USA), using manufacturer’s instructions for reverse transcription of total RNA ...