Labshake search
Citations for New England Biolabs :
6701 - 6750 of 6874 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The reaction was diluted to 100 µL with 1X T4 PNK (polynucleotide kinase) buffer and incubated for 30 min with 1 µL T4 PNK (10 U/µL; NEB M0201) to remove 3’ phosphoryl groups ...
-
bioRxiv - Genomics 2023Quote: ... Each tested enhancer sequence was cloned into the corresponding dual-enSERT-1 vector using NotI digestion followed by Gibson assembly methods (NEB, E2611) (Gibson et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-terminal truncation of murine STING (to include only amino acids 1-339) was accomplished using NEB Q5 High-Fidelity 2X Master Mix (NEB M0492S) per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Systems Biology 2023Quote: ... four building blocks needed to be prepared: 1) the backbone by digesting pDL00212 with BstEII-HF (New England Biolabs, Ipswitch, MA) and BamHI-HF (New England Biolabs ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were stained with ush Stellaris and lacZ Stellaris probes (Frampton et al., 2022) and nuclei were stained with DAPI (1:1000, NEB 4083). Samples were mounted in ProLong Diamond antifade mountant (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
bioRxiv - Genomics 2024Quote: ... Supplementary Table 1) using a modified protocol of the NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Biolabs, UK) (Supplementary Methods and Supplementary Table 18 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the genomic region (∼2000 bp) surrounding the natural start codon on exon 1 was cloned into the pUC19 vector (New England Biolabs, N3041S) by Gibson Assembly ...
-
bioRxiv - Microbiology 2024Quote: ... An enzymatic cleanup was done to remove primer dimers and inactivate nucleotides by directly adding 0.5µL of Antarctic phosphatase and Exonuclease 1 (New England Biolabs, Inc; M0293L, M0289L) and 1.22µL Antarctic phosphatase buffer (1x final concentration ...
-
bioRxiv - Molecular Biology 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Biochemistry 2024Quote: ... was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB, M0264L) for ssDNA digestion at 37°C for 1 hour ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... with or w/o 500 µM auxin and the same volume of 2x Monarch DNA/RNA Protection Reagent (NEB #T2011-1) was added before snap-freezing and storage at −80°C until RNA extraction.
-
bioRxiv - Microbiology 2024Quote: ... The pBAD33 plasmid harboring the stem structure of rrsH (corresponding to -131∼-102 and +1559∼+1589 relative to +1 of rrsH gene) under T7 promoter was linearized by digestion with XbaI (NEB, R0145).
-
bioRxiv - Microbiology 2024Quote: ... Rp6 was ligated to mono-phosphorylated transcripts at 37°C for 30 min by adding T4 RNA ligase 1 (#M0204, NEB, USA) with the buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4x106 JM8+/+ and Bmal1-/- cells were fixed with formaldehyde 1% and digested overnight at 37°C using 400U of MboI (New England Biolabs, #R0147M). After filling with 50nM biotin-dATP (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were electrophoresed and visualized on 1% agarose gels and then were cleaned using Exonuclease I and Shrimp alkaline Phosphatase (New England Biolabs Inc.). Both forward and reverse strands were sequenced using BigDye® Terminator v3.1 cycle sequencing kit ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA synthesis was performed from 1 µg total RNA using the ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs, NEB) with the provided random primer mix according to the suppliers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was generated from 1 μg of total RNA using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560).
-
bioRxiv - Molecular Biology 2020Quote: ... 13.5 μl digestion reaction product was combined with 1.5 μl second-strand synthesis (SSS) buffer and 1 μl of SSS enzyme mix from the NEBNext mRNA Second Strand Synthesis Module (NEB, Cat #E6111) and incubated at 16 °C for 2.5 h ...
-
bioRxiv - Genomics 2019Quote: ... for 1 h at 37 C followed by incubation with 80 U of TaqDNA ligase (New England Biolabs; 50 C/ 30 min). DNA was extracted ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A PCR reaction adding a T7 promoter/terminator pair on each aptamer (see Table 1) was carried out using Q5 High-Fidelity DNA Polymerase (New England Biolabs Inc.(NEB) #M0491 ...
-
bioRxiv - Biochemistry 2020Quote: ... NEB protocol #M0276 with incubation extended to 1 hour) and a Cap 0 analog (using a Vaccinia capping system, NEB protocol #M2080), following the recommended procedures ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). pEGFP-N1 and pEYFP-N1 were obtained from Clonetech (Mountainview ...
-
bioRxiv - Molecular Biology 2020Quote: Targeted sequencing for specific off-target or on-target sites was performed via a standard 2-step PCR using gene-specific primers with adaptors in the first round of PCR amplification and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (New England Biolabs) for the second round of PCR amplification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparations were performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, Ipswich, Massachusetts). Library preparation followed the protocol outlined in Saeidi et al ...
-
bioRxiv - Genomics 2021Quote: ... 1 µg of genomic DNA was digested in a 40 µl volume of 1x CutSmart buffer with 1 µl of MFRE (MspJI or FspEI; New England Biolabs, Ipswich, MA) and 1.4 µl activator oligonucleotide (15 µM stock ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Twenty-four PCR reactions (24 x 50 μl) were performed with 1 U of Q5 high-fidelity polymerase (New England Biolabs®, M0491), 200 μM dNTPs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genes of interest were cloned into the pLenti CMVTRE3G eGFP Neo (w821-1) plasmid using a Gibson Assembly Master Mix kit (Cat# E2611S, New England Biolabs, Ipswich, MA). pLenti CMV rtTA3 Blast (w756-1 ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 ∼ 1.5 μl of DNA extract was added to 20 μl of PCR reaction mix containing standard PCR buffer and 1 unit of Taq DNA polymerase (Cat # = M0273, New England Biolabs, Beverly, MA). For long-range PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were prepared using 1 µg of RNA and the NEBNext Ultra™ II RNA Library Prep Kit (NEB, E7775) with rRNA depletion following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... purified Trx-FER-KD and FER-KDK565R proteins were treated with 1 μl of λ-phosphatase (λ-PP) (400,000 units/ml, New England Biolabs. P0753S) and 1 mM MnCl2 for 1-2 h at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... the truncated versions of cwr-1 and the histidine mutant plasmids were prepared using the Q5 Site-Directed Mutagenesis Kit (E0552S NEB, Ipswich, MA). Gibson assembly (E2611S NEB ...
-
bioRxiv - Microbiology 2020Quote: ... samples were washed in phosphate buffered saline (PBS) and labelled with 1:500 of 10mg/mL Hoechst 33342 (New England Biolabs, Cat# 4082S) for 10 min with a subsequent wash in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of total RNA was used as template for complementary DNA synthesis using MuLV reverse transcriptase (New England Biolabs, Cat. M0253L) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6ul eluted RNA was used for Small RNA libraries using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Small RNA libraries were prepared from the extracted 1ug total RNA or 100ng PIWIL1-antibody-pulled down RNA using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were diluted in the same Triton X 100 and BSA solution and suppliers and source were: primary 1:200 anti-CK20 rabbit D9Z1Z (New England Biolabs, Herts, UK), anti-CD31 mouse JC70/A (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 3 μl from 100 μl of enzymatically converted and 1 μl from 15 μl of bisulfite-converted DNA were PCR amplified with Q5U polymerase (NEB, Ipswich, MA) and primers (Supplemental Table 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were pooled and treated for 1 hr at 37°C with 25 U of Exonuclease I (NEB, Cat# M0293S) per 100 μL of pooled PCR reactions ...
-
bioRxiv - Genetics 2022Quote: The full-length ccf-1 cDNA clone was generated through PCR using the Q5® High-Fidelity DNA polymerase (New England BioLabs, M0491L) and cloned into the pDEST32 vector containing the GAL4 DNA binding domain (DBD ...
-
bioRxiv - Genomics 2022Quote: Poly-A libraries (figure 1 and related data) were constructed with the NEBNext Ultra RNA library prep kit for Illumina (New England Biolabs, Ipswich, USA), following the manufacturer’s instructions ...