Labshake search
Citations for New England Biolabs :
601 - 650 of 6949 citations for rno mir 206 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µl of extracted RNA was used in a TaqMan one-step qRT/PCR assay (Luna® Universal One-Step RT-qPCR Kit, NEB). TaqMan analysis was carried out with primer/probe combination described in Table 1 and analysis performed on the QuantStudio™ 6 Flex System (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2019Quote: ... First strand cDNA synthesis was performed using an oligodT and the ProtoScript Taq RT-PCR kit (New England Biolabs, Ipswich, MA). Second strand synthesis was performed with the NEBNext mRNA Second Strand Synthesis Module kit – E6111S (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2022Quote: ... One-step quantitative RT-PCR was used to determine gene expression levels using the Luna Universal One-Step RT-qPCR kit (New England Biolabs Inc.) according to the manufacturer’s recommendations using 4 ng of total RNA per 20µl reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... or treated with 0.1 mM carbonic anhydrase inhibitor – S4 for 24 h was subjected to semi-quantitative RT-PCR analyses using Q5 high-fidelity DNA polymerase (New England Biolabs Inc.) according to manufacturer’s protocol in a T100 Thermal cycler (BIO-RAD) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6ul eluted RNA was used for Small RNA libraries using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Small RNA libraries were prepared from the extracted 1ug total RNA or 100ng PIWIL1-antibody-pulled down RNA using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Kras cDNA was amplified in PCR reaction using the corresponding primers (Reagents) and Phusion Hot Start Flex polymerase (New England Biolabs, Ipswich, MA). cDNA fragments were purified with NucleoSpin gel and PCR clean-up columns (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2020Quote: ... This was immediately followed by ligation of Illumina adaptors and PCR amplification (for 9-12 cycles) using Illumina barcoding primers and Phusion DNA polymerase (NEB, Cat# M0530S). PCR products were double size-selected using the KAPA Pure beads (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... the genes were PCR-amplified using primers containing cut sites for the restriction enzymes EcoRI (forward) and SalI (reverse) (New England Biolabs, NEB, Australia) for gtr29 ...
-
bioRxiv - Genetics 2021Quote: Transposase reactions were initially amplified by 8 cycles of PCR using primers described by Buenrostro et al (2013) and 2X NEBNext Q5 HotStart HiFi Master Mix (New England Biolabs, Cat# M0543). Amplicons of 175 -250bp were size-selected using agarose gel electrophoresis on BluePippin 2% gel cassettes (Sage Science ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes for Po-EgfrA were synthesized from a PCR template using universal T7 primers and T7 polymerase (New England Biolabs, MA, USA). RNA probes for Popi-Dfd were synthetized from the plasmid template of Popi-Dfd3’ using T7/T3 RNA polymerase (New England Biolabs ...
-
bioRxiv - Systems Biology 2019Quote: ... The cDNA inserts were PCR-amplified using primers specific for either the N- or C-terminal libraries using Phusion DNA polymerase (New England Biolabs, Ipswich, MA). Amplicons were PCR-purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... Homology arms of ~800 bp were amplified from genomic DNA using PCR primers with 40 bp overhangs compatible with pUC19 backbone digested with Xba1 and Ecor1 (New England Biolabs, Ipswich, MA) (sequences in the table below) ...
-
bioRxiv - Biochemistry 2021Quote: ... Vectors used to construct plasmids containing the bbu genes were linearized by PCR amplification from 10 ng vector template DNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). Thermocycling was carried out in a Bio-Rad C100 thermal cycler using the following parameters ...
-
bioRxiv - Biochemistry 2021Quote: ... timonensis SN18 gDNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). A plasmid based on the pET28a(+ ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Neuroscience 2019Quote: ... Clones were screened for Phf15 deletion using PCR (primers Forward: agcacacttgtaaccctcct and Reverse: gaccaatgtctgttgttgttcg) followed by restriction digest with BtgI (New England Biolabs, Ipswich, MA). Percent decrease in Phf15 mRNA transcript expression was determined via RT-qPCR (primer sequences are listed in Supplementary Table 1).
-
bioRxiv - Neuroscience 2022Quote: ... SARS-CoV-2 cDNA was subsequently amplified using ARTIC network v2 primers using two-step PCR amplification with Q5® High-Fidelity DNA Polymerase (New England Biolabs, USA). PCR fragments were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Single primer PCR was performed in 2 different tubes for each plasmid using Q5 2X Master Mix (New England Biolabs Cat.No M0492S). After the amplification ...
-
bioRxiv - Immunology 2020Quote: ... with Poly(A) mRNA Magnetic Isolation Module (CAT#E7490S) and index PCR primers (CAT #s E7335, E7500) (New England Biolabs; Ipswich MA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 hypervariable region of the 16S rRNA bacterial gene (515-806) was amplified using specific primers with the barcodes with Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA). PCR amplicons from each sample were pooled in equimolar amounts and purified using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the PCR products (primers shown in Table S1) were digested with AvaII and HpyCH4IV restriction enzymes (New England BioLabs; Ipswich, MA, USA), respectively ...
-
bioRxiv - Synthetic Biology 2022Quote: ... encoding a 7-mer insertion between amino acid residues 588 and 589 of AAV9 was used as the reverse primer along with the Assembly-Xbal-F oligo (CACTCATCGACCAATACTTGTACTATCTCT) as a forward primer in a PCR reaction using Q5® High-Fidelity 2X Master Mix (NEB #M0492S) following the manufacturer’s protocol for 30 cycles with 10 ng pUC57-wtAAV9-X/A plasmid.
-
bioRxiv - Microbiology 2019Quote: ... A high fidelity PCR was performed with the same 16S primers but using Q5 Hot start 2x master mix (New England Biolabs, Hitchin, U.K.). After amplification ...
-
bioRxiv - Microbiology 2019Quote: ... each of the amplicons were diluted to 0.5 nM and amplified using barcoding primers (1D PCR Barcoding Amplicon Kit, Oxford Nanopore Technologies, [ONT], UK) and LongAmp Taq 2X Master Mix (New England Biolabs, MA, USA) with the following conditions ...
-
bioRxiv - Molecular Biology 2019Quote: ... ∼1 kb regions containing the gRNA target were amplified using appropriate PCR primers (Table E2) and Q5 DNA Polymerase (New England Biolabs, Ipswich, MA) and purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... individual oligo libraries were PCR-amplified using 15 nt amplification primers with Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA), and number of cycles determined by qPCR ...
-
bioRxiv - Pathology 2020Quote: ... Candidate colonies were screened using external primers (Table S1) by PCR using Phusion HiFi polymerase according to the manufacturer’s instructions (New England BioLabs, Ipswich, MA, USA). Candidates with the expected PCR fragment size were sequenced using external primers to confirm the knock-out of the gene fragment.
-
bioRxiv - Microbiology 2020Quote: ... plus 280 nM for each primer and the standard reagents in the Phusion High-Fidelity PCR Kit (New England BioLabs, Ipswich, MA). Samples were then cycled under the following qPCR conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Cell Biology 2020Quote: ... TopBP1 full-length cDNA (a kind gift from Lee Zou) was amplified by PCR with primers 1 and 2 using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, CM0530). The forward and reverse primers contain AscI and NotI sites ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Plant Biology 2022Quote: ... employing triple template PCR as described128 with primer sequences listed in Supplementary Table S1 using the Q5 polymerase (New England Biolabs, Ipswich, USA). The knockout constructs were released from their vector backbones with XhoI (PpAARE1) ...
-
bioRxiv - Systems Biology 2024Quote: ... The dsRNA sequence region of each gene was amplified with the gene-specific primer pair using Q5 high-fidelity PCR (New England BioLabs, Ipswich, MA). The sense and antisense dsRNA sequence fragments conjugated with the T7 promoter sequence were amplified separately using the previous PCR amplicons as templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR was then performed in a mix of 10 µM Nextera i7 and i5 primers and NEBNext Q5 High-Fidelity PCR Master Mix (New England Biolabs, MA, USA) according to the following protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae REV7 gene was amplified from genomic DNA by PCR using the primer pair (forward OSB01 and reverse OSB02) and Phusion DNA polymerase (NEB, Ipswich, MA) as described (Sambrook and Russell ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR cycles were carried out with Illumina Nextera adapter primers using the NEBNext High Fidelity 2x Master Mix (NEB, Cat# M0541S) using the following PCR program ...
-
bioRxiv - Microbiology 2024Quote: ... isolated DNA from MPA/xanthine selected parasites was PCR amplified using GRA6 primers and the purified amplicon was fragmented with MseI (NEB cat# R0525M). Products were run on a gel to determine parasite type I or III based on unique fragmentation sizes indictive of the genotype.
-
bioRxiv - Neuroscience 2020Quote: ... Tough decoy for miR-124 was synthesized (GeneScript) and subcloned into pLemir vector using MluI (NEB, R0198) and NotI sites.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 3 thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermo-cycler ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR reagents (NEB, E3005) and the primers listed in Table S3.
-
bioRxiv - Molecular Biology 2023Quote: ... The reverse-transcription (RT) reactions were performed with 2X LunaScript RT SuperMix Kit (NEB) with 5 μL of RNA input (250 ng of RNA total ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed with Luna Universal One-Step RT-qPCR Kit from NEB on BioRad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a NEBNext Multiplex Oligos set (e.g. NEB E7335S). 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... NEBNext Multiple Oligos for Illumina Set 1 (NEB #E7335), 2 (NEB #E7500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a NEBNext Multiplex Oligos set (e.g. NEB E7335S). An initial test amplification was used to determine the optimal cycle number for each library ...