Labshake search
Citations for New England Biolabs :
601 - 650 of 1760 citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 3 μL USER Enzyme (NEB, Ipswich, MA, UK) was incubated with size-selected ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Then 3 μl USER™ Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biochemistry 2019Quote: ... and 4ul of 10X NEB buffer 3 (NEB) was added to the reactions and incubated for an extra 20 min at 30°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 U WarmStart RTx Reverse Transcriptase (NEB, #M0380S), 0.2 μM F3/B3 primers ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 3 ul Proteinase K (NEB, P8107S). Samples were incubated for 1 hr at 56°C ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA 3’-ends were dephosphorylated using rSAP (NEB) and ligated to either the Universal miRNA Cloning Linker (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µl of T4 polynucleotide kinase (NEB, M0201L) and 4 µl of terminal deoxynucleotidyl transferase (Enzymatics ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding Sd223-440 was PCR amplified and inserted into a pET28-derived vector providing an N-terminal His-HRV3C-Avi-tag by HiFi DNA Assembly Cloning (New England Biolabs, Ipswich, MA) according to the instructions of the manufacturer ...
-
bioRxiv - Biochemistry 2020Quote: ... was PCR amplified and inserted into a pET28-derived vector providing an N-terminal His-HRV3C-tag by HiFi DNA Assembly Cloning (New England Biolabs, Ipswich, MA) according to the instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepared using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis was performed to change Arg106 to a histidine (His) using Q5® Site-Directed Mutagenesis Kit (New England Biolabs Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library for Illumina sequencing was prepped using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments and the pABC3-His or pABC3-GFP vector were digested with PacI and NotI restriction enzymes (New England Biolabs, MA, USA). Resultant fragments were then gel-purified using the Monarch DNA Gel extraction kit (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext Ultra II DNA library Prep Kit for Illumina (NEB Cat# E7645S) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Singh et al 2014) were synthesized (Integrated DNA Technologies, Research Triangle Park, NC) and assembled by Hi-Fi assembly (New England Biolabs, Ipswich, MA) into a modified pCAMBIA0380 expression construct (Genbank AF234290.1 ...
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Miip CDS was amplified by PCR and cloned into LV17 (EF-1α-Luciferase-puro) shuttle vector (GenePharma, Shanghai, China) with restriction enzymes Not I and Bam HI (New England Biolabs, Ipswich, MA). For mouse Miip specific knock-down ...
-
bioRxiv - Biochemistry 2024Quote: ... Digestion was set up to remove the 6X-His-tag by incubating with either homemade or store bought (NEB, Cat. no: P8070L) enterokinase in the presence of 10mM CaCl2 at 22°C for 16h ...
-
bioRxiv - Molecular Biology 2019Quote: ... After annealing the complex an equimolar amount was mixed with 1000ng Cas9 recombinant protein (NEB; final conc 20ng/ul) and incubated at RT for 15’ ...
-
bioRxiv - Genetics 2019Quote: P2C-Cas9 and P2C-EGFP proteins were expressed from pET28a-P2C-Cas9 and pRSET-P2C-EGFP respectively by recombinant BL21 E.coli (NEB) as described in detail in Chaverra-Rodriguez et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg each of the recombinant proteins were lyophilized and digested with PNGase F (P0701S, New England Biolabs Inc.) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... were used to amplify the pQE60- ompA recombinant plasmid (Size- 4.5 kb) using Phusion high fidelity DNA polymerase (NEB). The reaction mixture was heated at 950C for 10 minutes for the plasmid’s denaturation ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Genetics 2022Quote: ... Eggs were then injected under air-dry conditions with a solution containing 300ng/μl of recombinant Cas9 Nuclease (NEB) and 100ng/ul each of four sgRNAs targeting the first exon of the Oatp74D gene (S2 Table) ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant plasmids encoding a catalytically inactive 3Dpol (3Dneg) were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). Nucleotides at position 6891 and 6892 of the CVB3/28 genome were mutated from AT to GC ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pelleted at 500 x g for 5 minutes and resuspended in 8µg/mL recombinant albumin (New England Biolabs) in dPBS-/- ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...