Labshake search
Citations for New England Biolabs :
601 - 650 of 10000+ citations for Mouse T cell receptor alpha chain C region TCRA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: The target regions of the gDNA were amplified by touch-down PCR using Q5® Hot Start High-Fidelity DNA Polymerase (NEB). Approx ...
-
bioRxiv - Microbiology 2021Quote: ... Between 1-2kb of flanking regions upstream and downstream of the region of interest were amplified from parental strain using Q5 2x Master Mix (New England Biolabs, USA). The antibiotic resistance gene ermB was amplified from S ...
-
bioRxiv - Microbiology 2019Quote: ... Between 1-2kb of flanking regions upstream and downstream of the regions of interest were amplified from parental strains using Q5 2x Master Mix (New England Biolabs, USA). The antibiotic resistance gene ermB was amplified from S ...
-
bioRxiv - Genetics 2021Quote: ... We then recombined 500ng of this digestion (including ∼4.4kb of backbone vector and 250bp of filler sequence including a spliced region and truncated GFP ORF) with 150ng of both the purified enhancer and promoter products using Gibson assembly (NEB, E2611) for 1 hour at 50°C in a 40uL reaction and purified the reaction using 1X volume AMPure XP with 3 total ethanol washes.
-
bioRxiv - Genomics 2020Quote: ... and used for PCR amplification of the target region using the Q5® Hot Start High-Fidelity 2× Master Mix (NEB), followed by evaluation of the PCR products by gel electrophoresis and purification with the Qiaquick PCR purification kit (28104 ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... including the stop codon and (2) the CDS and native promoter region 1024 bp upstream using Phusion High Fidelity DNA polymerase (NEB, USA) and TA-ligated into the entry vector pCR8/GW/TOPO (Thermo ...
-
bioRxiv - Microbiology 2022Quote: The coding region for OspA with its native intergenic promotor was amplified by PCR with Q5 thermostable high-fidelity polymerase (NEB, M0491) from B31-e2 genomic DNA with primers 35 and 36 (Table 1 ...
-
bioRxiv - Genetics 2023Quote: ... were genotyped by amplifying the fourth coding region of EDNRB1 via PCR and digesting the PCR products with the restriction enzyme BsrI (New England BioLabs, #R0527S). Both deletions eliminate cut sites for BsrI and can thus be genotyped simultaneously (S1 Fig) ...
-
bioRxiv - Microbiology 2023Quote: ... The unique barcoded region was amplified from 500ng genomic DNA with 16 cycles of PCR using NEBNext Ultra II Q5 master mix (NEB M0544L) as described in30 ...
-
bioRxiv - Genomics 2023Quote: ... were synthesized to amplify the genome-edited region of the corresponding genes using Phusion high-fidelity DNA Polymerase (New England Biolabs, M0530L). For each PCR reaction of 50 μl volume ...
-
bioRxiv - Microbiology 2023Quote: ... antibiotic resistance cassette and 2 flanking regions were combined in equimolar amounts and mixed with 2 x HiFi reagent (NEB, UK) and incubated at 50°C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... was modified with a guide RNA (GTCGGACGCGAAACTCGCTT) to target the 5’ region of the ROP33 gene (sgROP33) using Q5 mutagenesis (New England Biolabs, MA). Then a CRISPR/Cas9 replacement construct was created using Gibson assembly (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... was genotyped by amplifying the fifth coding region of EDNRB1 via PCR and digesting the PCR products with the restriction enzyme SmaI (New England BioLabs, #R0141S). The R315P variant creates a cut site for SmaI (S2 Fig) ...
-
bioRxiv - Bioengineering 2023Quote: ... Specific donor sequences for small edits were encoded in primers and substituted into the RT-DNA-encoding region of the ncRNA with a PCR and KLD reaction (NEB M0554). Donor sequences for larger insertions were cloned through Gibson assembly ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix, NEB #E2621). The U6 promotor and the invariant scaffold are separated by a unique BsmBI restriction site using Q5® Site-Directed Mutagenesis Kit (NEB #E0554) ...
-
bioRxiv - Microbiology 2024Quote: ... The full-length coding region with introns spliced out of PIGJ was amplified using the Q5 high fidelity polymerase (NEB, M0491) from a CEP cDNA library preparation using primers designed to contain 19 bp homology with the 3’ end of the PIGJ promoter sequence and 25 bp homology with end of the digested pLIC-HA plasmid that contains and provides a 3x HA tag ...
-
bioRxiv - Genomics 2023Quote: Purified PCR1 products (landing pad insert) were amplified for each of COMT target regions in a 50 µL NEB Q5 reaction (NEB, M0491) for 8 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... hcp and tssB flanking regions were PCR-amplified from CFBP13503 with the Phusion High-Fidelity DNA polymerase (New England Biolabs, France), and the primer pairs listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was digested with Msel (T^TAA; New England Biolabs, Ipswich, MA, USA) and ligated to adapters containing a sample identifier sequence ...
-
bioRxiv - Genomics 2020Quote: ... mRNA was enriched with Oligo d(T)25 Magnetic Beads (New England Biolabs) and fragmented by heating at 94 °C for 3 min in 5× First Strand Buffer (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 15 µl of Oligo d(T)25 Magnetic Beads (S1419S, New England Biolabs), were combined with 50 µl of binding buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2021Quote: ... samples were incubated with 20 μl Oligo d(T) Magnetic Beads (NEB, S1419S) in PCR strips for selection of polyadenylated (poly(A) ...
-
bioRxiv - Genomics 2021Quote: ... mRNAs were incubated with Oligo d(T) Magnetic Beads (New England BioLabs S1419), then fragmented in 2x Superscript III first-strand buffer (Thermo Fisher Scientific with 10mM DTT (Thermo Fisher Scientific 18080044 ...
-
bioRxiv - Genomics 2022Quote: ... mRNA was isolated using Oligo d(T)25 Magnetic Beads (New England Biolabs) and fragmented ...
-
bioRxiv - Genomics 2022Quote: ... mRNAs were enriched by incubation with Oligo d(T) Magnetic Beads (NEB, S1419S) and then fragmented/eluted by incubation at 94°C for 9 min ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... mRNA molecules are captured using magnetic Poly(T) beads (NEB, catalog no. E7490L) following purification ...
-
bioRxiv - Cell Biology 2022Quote: ... and transformed into competent DH5a E. coli (5-alpha Competent E. coli) following the protocol provided by the company (New England Biolabs, Ipswich, MA). For colony selection ...
-
bioRxiv - Microbiology 2021Quote: ... The amplicon was cloned into the pTXTL-T7p14-aH plasmid (replacing alpha hemolysin, Daicel Arbor Biosciences, Ann-Arbor, MI) using NcoI-HF and SmaI (New England Biolabs, Ipswitch, MA). The new plasmid construct (pSLP15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then carried out rRNA depletion with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat NEB # E6310S) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Microbiology 2019Quote: ... and the mixture incubated at 37°C for 1 h prior to the transformation into XL10Gold cells (NEB) (Table S8) ...
-
bioRxiv - Biophysics 2020Quote: ... SecA(N95) K797C was overexpressed for 4 hours at 37 °C in E.coli NiCo21 cells (New England Biolabs) grown in 2xYT (Acumedia ...
-
bioRxiv - Biophysics 2021Quote: ... The AcrIIA4 expression vector was modified to express AcrIIA11 with a C-terminal NLS and HA tags using the HiFi Assembly Kit (NEB).
-
bioRxiv - Biochemistry 2022Quote: ... a cysteine was added to the N-terminus of the coding sequence directly after the precision protease recognition site or after the six-histidine tag on the C-terminus using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: Micro-C sequencing libraries were generated by using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) with some minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... C and 5mC deamination reaction was performed using the APOBEC3A enzyme (NEBNext® Enzymatic Methyl-seq Kit, New England Biolabs) with the following ramping conditions ...
-
bioRxiv - Microbiology 2020Quote: ... A bacteria-codon optimized gBlock for the truncated protein was produced by IDT DNA Technologies and cloned into a pET28a bacterial expression with a C-terminal 6xHis tag using the NEBuilder Assembly Kit (New England Biolabs). Recombinant protein was expressed in BL21(DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription (IVT) was performed at 37°C for 13-16h with the HiScribe T7 RNA Polymerase kit (NEB). The remaining DNA was digested by Turbo DNase I (Life Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... Six histidine residues were added to the C-terminus of the sequence via the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resulting vector was transformed into OverExpress C41(DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... digestion at 37°C for 30 minutes and then purified with the Monarch RNA Cleanup Kit (T2050, New England Biolabs) for long RNA (1020 nucleotides to 4187 nucleotides ...
-
bioRxiv - Cancer Biology 2020Quote: ... eluted in 8 μl and in vitro transcribed (with the beads) at 37 °C overnight for linear amplification using the T7 High Yield RNA polymerase IVT kit (NEB). Following IVT ...
-
bioRxiv - Cancer Biology 2021Quote: ... chromatin from both IP and ‘Input’ samples were eluted and de-crosslinked at 65°C for 16 hours followed by DNA isolation by PCR and DNA cleanup kit (NEB). Enrichment of AR and MED1 at specified enhancers were quantified by qPCR using specific primers ...
-
bioRxiv - Biochemistry 2020Quote: ... at 95°C for 5 min and incubated with 80000 units of O-glycosidase and 100 units of neuraminidases for 4 hours at 37°C following the NEB kit protocol (E0540S; NEB). Samples were resolved on 15% Tris-tricine SDS-PAGE gel and blotted using anti-Cterm OCN goat antibody.
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: MBOAT7 mutants were generated by site-directed mutagenesis on the pFBM construct expressing MBOAT7 with a C-terminal GFP and strep tag using the Q5 Mutagenesis Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... and C-terminal truncations (-57Q, -56IQ, -55DIQ and -54DDIQ) were performed on phyg-C-CSNAP-cerulean using the Q5 mutagenesis kit (NEB). HAP1 WT cells were transfected with 5 μg plasmid DNA using JetPRIME (Polyplus) ...