Labshake search
Citations for New England Biolabs :
601 - 650 of 8755 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... adaptors ligation with Quick Ligation kit (NEB, cat. M2200) and amplification with Phusion Flash HF PCR master mix (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... and ligated using Quick Ligase Kit (New England BioLabs) according to manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... with NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S). The details of plasmids source and usage are listed in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purification with a PCR clean-up kit (NEB) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... and assembled using Gibson Assembly Cloning Kit (NEB, E5510S) according to manufacturer instructions ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... and library quantification using NEBNext Library Quant kit (NEB), the sequencing was performed under the setting of single read 1×51 bp to generate ∼30 million reads per sample on HiSeq 1000 sequencer (Illumina).
-
bioRxiv - Bioengineering 2024Quote: LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA using primers oAS344 for cRNA and oAS345 for vRNA (Supplementary Note 21).
-
bioRxiv - Developmental Biology 2024Quote: ... and purified using the Monarch RNA Cleanup Kit (NEB) and stored at −80 °C before use ...
-
bioRxiv - Molecular Biology 2023Quote: ... a site-directed mutagenesis kit (New England Biolabs Q5) was used ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reactions were purified with a PCR purification kit (NEB). Approximately 120–150 ng of DNA was used as a template for a T7 in vitro transcription (IVT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: Sequencing libraries were prepared using either the “NEBNext Ultra II DNA Library Prep Kit for Illumina®” (E7645) or the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina®” (E7805) (New England BioLabs, Ipswich, USA). Sequencing was conducted on an Illumina MiSeq System (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The described method follows the NEBNext® Ultra™ II DNA Library Prep Kit (v4.0) with Sample Purification Beads Kit (New England Biolabs, Ipswich, Massachusetts, USA). But other kits can be used too ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc., Ipswich, Massachusetts, U.S.) and the NEBNext Multiplex Oligos for Illumina were used for library preparations ...
-
bioRxiv - Developmental Biology 2019Quote: ... An amount of 500 ng total RNA was used for RNA-seq library preparation with NEB NEBNext rRNA Depletion Kit and ENBNext Ultra Directional RNA Library Prep Kit (New England Biolabs Japan Inc., Tokyo, Japan); 2 × 36 base paired-end sequencing was performed with NextSeq500 (Illumina K.K. ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples with a RIN greater than 7 were processed for library preparation with NEBnext rRNA depletion kit and ULTRAII FS RNA-seq Library Preparation Kit for Illumina (New England Biolabs, Ipswich, MA, United States). This procedure involved steps for mRNA enrichment ...
-
bioRxiv - Microbiology 2020Quote: ... NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB), and NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the Q5® site-directed mutagenesis kit (New England Biolabs) was used on the Patgl-1::GFP plasmid previously generated (Noble et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Cypridina Luciferase Assay Kit (New England Biolabs) and Gaussia luciferase was assayed from 1:40 diluted cell culture supernatant using either the Stop & Glo reagent from the DualLuciferase® Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Gaussia Luciferase Assay Kit (New England Biolabs) in a Lumat LB 9507 luminometer (Berthold Technologies).
-
bioRxiv - Immunology 2021Quote: ... NEXTFLEX barcodes were ligated using the Quick Ligation Kit (NEB). Libraries were amplified for 15 cycles using HotStart HiFi Ready Mix (KAPA) ...
-
bioRxiv - Immunology 2021Quote: ... and NEBnext Ultra II RNA library prep kit (NEB E7770S). Briefly ...
-
bioRxiv - Genetics 2019Quote: ... mRNA was enriched using an NEBNext rRNA Depletion kit (NEB). Libraries for sequencing were prepped using an NEBNext Ultra II Library prep kit for Illumina (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Capped mRNA was synthesized using the HiScribe SP6 kit (NEB) and purified using the RNA Clean & Concentrator kit (Zymo) ...