Labshake search
Citations for New England Biolabs :
601 - 650 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Inserts were then digested according to manufacturer’s protocol with Nsi-I HF and Hind-III HF and ligated into a calf-intestinal phosphatase treated plasmid using T4 DNA ligase (New England Biolabs). The resulting recombinant plasmid contained an ampicillin resistance cassette and the riboswitch insert located upstream of the fluorescent reporter protein mNeonGreen.79 The plasmid’s transcription is controlled by the moderately strong synthetic promotor ‘proD’80 which has previously been used to study the env8 class-II Cbl riboswitch.59 ...
-
bioRxiv - Neuroscience 2023Quote: ... This was confirmed in N1 heterozygous AtrxR245C/+ females after digestion of the wild-type allele using FspI (NEB R0135S) and gel purification of the uncut mutant band ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of entry vector (backbone), 0.5 μL of type IIs restriction enzyme (BsaI, BsmBI or BbsI-HF) (NEB), 0.5 μL of T4 DNA Ligase (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... We pooled the second set of eBlocks at equal molar ratio and used Esp3I Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Molecular Biology 2024Quote: The C-type CA sequence was cloned into pCMVHTLV_delta env (kind gift from Dimitry Mazurov) by Gibson Assembly (NEB) and all subsequent point mutations were introduced by standard overlapping PCR ...
-
bioRxiv - Molecular Biology 2024Quote: Nanobody coding sequences were subcloned into the pHEN6.1 vector via a second round of Type IIs enzyme assembly using BsaI (NEB). In a 0.2 mL PCR tube on ice ...
-
bioRxiv - Plant Biology 2024Quote: ... pDGE9 and pDGE11 respectively45 via a Golden Gate reaction with the type-IIS restriction endonuclease BpiI (New England Biolabs). These were then simultaneously transferred into a single vector via a Golden Gate level 1 reaction with BsaI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... padlock probe ligation was performed overnight O/N at 25°C using the SplintR ligase (NEB, M0375) at a final concentration of 0.5 Units/μl ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL of endo-β-N-acetylglucosaminidase-H (Endo-H, EC 3.2.1.96) (New England Biolabs™) and incubated in the thermomixer at 37 °C for one h ...
-
bioRxiv - Cell Biology 2020Quote: ... then deglycosylated with 2000 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA). All samples were incubated for 16 hours at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... with a cleavable Glutathione-S-Transferase (GST) tag at the N-terminus) and pMALTMc5X (New England Biolabs, USA ...
-
bioRxiv - Genetics 2023Quote: We performed n=30 PCR1 reactions per sample using Q5 High Fidelity 2X Master Mix (NEB #M0429S) with 10 ug of genomic DNA to maintain ≥1000X representation ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Genomics 2020Quote: We used the prepared DNA of each clone and the wild type gene for amplification by PCR with Q5 polymerase (NEB) using primers which included the minION barcodes adapters ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Biophysics 2021Quote: ... The 5’-terminus was capped with a type I 7-methylguanosine cap (m7G) using the Vaccinia Capping System (NEB, M2080S) and 2’-O-methyltransferase (NEB ...
-
bioRxiv - Bioengineering 2020Quote: In-vitro digestion reactions were carried out with three different types of the Cas12a family (LbCas12a, AsCas12a, and FnCas12a were purchased from New England Biolabs Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Cell Biology 2021Quote: To generate inducible vectors for MST2 wild type and del EDG we amplified the Flag2x _Strep2x fused to the MST2 constructs (wild type and del_EDG) with Q5 High-Fidelity Polymerase (New England BioLabs, # M0492) using specific primers (EcoRI_Flag_Fw and MST2_AgeI_Rv ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg of total RNAs from wild type LCL 25 and LCL MM were treated with DNAse I (M0303S-NEB), and reverse transcription was carried out with random hexamer primers (S0142-Thermo Scientific™ ...
-
bioRxiv - Biophysics 2022Quote: ... the assembled sequences were transferred to the target plasmids (WT, MUT) by using a different set of type IIS enzymes (BbvI, New England Biolabs #R0173 ...
-
bioRxiv - Microbiology 2022Quote: The full-length badR gene was amplified from the genome DNA of the wild-type Borrelia using High-Fidelity Taq Polymerase Fusion (NEB). The fragment was subsequently ligated into the pMAL-c2X (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The relative abundance of oligomannose-type glycans was measured by digestion with Endoglycosidase H (per sample in 20 µl volume) (Endo H; New England Biolabs). A 6 µl aliquot of labelled glycans was combined with 1 µg endoH to a final volume of 20 µl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Multilayer genetic circuit plasmids were constructed using PCR and Golden Gate assembly (GAA) using BsmBI Type IIS Enzyme (New England Biolabs), and sRNA plasmids using BsaI Type IIS Enzyme (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2024Quote: All replicative plasmid backbones were constructed using the Golden Gate Assembly strategy with the type II restriction enzyme Esp3I (NEB) according to the manufacturer’s protocol (Table 1) ...
-
bioRxiv - Evolutionary Biology 2024Quote: DNA fragments for wild-type and mutant GART were ordered from IDT (see below) and PCR amplified with Phusion DNA polymerase (New England Biolabs) with FWD_adapter and REV_adapter primers from IDT (see below) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Genomics 2024Quote: ... and the wild-type (USH2A:c.7595-2144A) minigene plasmids were generated by Q5® High-Fidelity DNA Polymerase (New Englands Biolabs) amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... Variants of the Bil system were generated by amplification of the plasmid containing the wild-type Bil system12 using primers that contained the desired modification followed by treatment with KLD enzyme mix (NEB) according to the manufacturer’s instructions to obtain transformable plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isoseq library preparation was performed on 300 ng of RNA (RIN ≥ 9.3) of each cell type (isolated as described above) using NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification (NEB), Iso-Seq Express Oligo Kit (PacBio ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were combined into a transcription unit plasmid in a Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs). The destination vector (p15A origin of replication ...
-
bioRxiv - Immunology 2024Quote: ... the wild type and mutant pBlueScript SK(+) HEV plasmids were linearized at their 3′ end with the MluI restriction enzyme (NEB) and transcribed with the mMESSAGE mMACHINE T7 Transcription kit (Ambion #1344) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplicons were then cloned into the wild-type SsCBE-UGI-C2 vector using Gibson Assembly Master Mix (New England Biolabs). The cjSsCBE2 was constructed by exchanging APOBEC1 domain of cjCBEmax to SsdAtox-SRE domain ...
-
bioRxiv - Microbiology 2024Quote: ... 100ng of genomic DNA were used as input for the type VI-A array enrichment PCR with Q5 High-Fidelity DNA polymerase (NEB) and 0.4µM final concentration of each primer ...
-
bioRxiv - Plant Biology 2024Quote: ... CCGAGGTTACCCACGTCGCTTTGCT developed using dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html) (Neff et al., 2002) and wild-type fragments were digested with Ava II restriction enzyme (NEB, R0152). Double and triple mutants were obtained after crossing their respective parents ...
-
bioRxiv - Biochemistry 2024Quote: ... A truncated version of this wild-type VgrS lacking the first 81 amino acids was created by Q5-mutagenesis (NewEngland Biolabs, NEB) to generate VgrS (residues 81-729 ...
-
bioRxiv - Microbiology 2020Quote: ... or CatL-cleaved GPs were incubated with Protein N– glycosidase F (PNGaseF, 250U; New England Biolabs, Ipswich, MA) under reducing conditions for 16 h at 37℃to remove N–linked glycans ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...