Labshake search
Citations for New England Biolabs :
601 - 650 of 7127 citations for E 6 2 6 6 Trimethylcyclohex 2 en 1 yl hex 5 ene 2 4 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... SNAP-Cell TMR Star (2 mM in DMSO, NEB), and SNAP-Cell Block (2 mM in DMSO ...
-
bioRxiv - Biochemistry 2023Quote: ... and SNAP-Cell Block (2 mM in DMSO, NEB) were prepared and stored as aliquots in the dark at –20 °C ...
-
bioRxiv - Genomics 2023Quote: ... and digested with 2 units of β-agarase (NEB) (42°C ...
-
bioRxiv - Microbiology 2024Quote: ... 200 U T4 RNA ligase 2 truncated KQ (NEB), 1x T4 RNA ligase buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 2 mg/mL temperature labile proteinase K (NEB, P8111S), and 12.5 mM MgCl2 for RNA fragmentation) ...
-
bioRxiv - Biochemistry 2024Quote: ... using Q5® High-Fidelity 2× Master Mix (NEB) and 200 nM of each primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 25 µl NEBNext HiFi 2× PCR Master mix (NEB) was immediately added and mixed before proceeding to PCR cycles (58 °C for 5 min (gap filling) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2 U of Phusion polymerase (New England Biolabs). Reactions were initially denatured at 98 °C for 30 s ...
-
bioRxiv - Genomics 2024Quote: ... and 25 μL 10xNEB buffer 2 (NEB B7002 RT) were added to the reaction and incubated at 37°C for 2 hours with rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL 10× T4 RNA Ligase Reaction Buffer (NEB), 6 µL PEG8000 (50%) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 µl of DNase I (2500U/mL, NEB) for each mL of B-PER reagent used ...
-
bioRxiv - Synthetic Biology 2024Quote: ... T4 RNA Ligase 2 (10U/µl New England Biolabs) and were incubated at 37°C for 2 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... Residual RNA was digested with 2 units RNaseH (NEB) for 20 min at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 units of polymerase (New England Biolabs M0254). Vent exo– (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 25 µL of 2× Q5 Master Mix (NEB, UK) enzyme mix ...
-
bioRxiv - Genetics 2024Quote: ... and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved for later use in 70% EtOH at -20°C ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 μL of BsaI-HFv2 (NEB, 20000 U/mL), 2 μL of T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... The digestion experiments used 2% AluI or MNase (NEB), 10% NEB CutSmart buffer or MNase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Microbiology 2024Quote: ... Next, the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... 0.5 µl of 2 µM UPA-long and 0.25 µl Phusion Hot Start Flex DNA Polymerase (New England Biolabs) were added to 15.25 µl nuclease-free water ...
-
bioRxiv - Biochemistry 2024Quote: The 9N_VRA3 adapter oligonucleotide (0139, Supplementary Table 2) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) using the following protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... pre-tRNA stock was diluted 1 in 2 into RNA loading buffer (New England Biolabs) and separated on a 10% acrylamide urea-TBE denaturing gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 1-2 µg phi47 DNA was treated with Nucleoside Digestion Mix (New England Biolabs) following the manufacturer’s protocol at 37°C for >2h ...
-
bioRxiv - Microbiology 2024Quote: ... with NEBNext® Multiplex Oligos for Illumina Dual Index Primers Sets 1 and 2 (NEB). Manufacturer’s instructions were followed except the post-ligation bead clean-up ...
-
bioRxiv - Microbiology 2021Quote: ... primers oJV5-6 were used to remove ackA from pJV204 using the Q5 site-directed mutagenesis kit (NEB CN# E0554S) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Systems Biology 2020Quote: The extracted plasmids were amplified using “lib-seq” primers in the Supplementary Table 6 for 10 cycles using Phusion PCR kit (NEB). Each 50 μL PCR reaction consisted of 6 μL of plasmid library ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 6 h at 37°C in the absence or presence of RNase H or RNase A (40 U, NEB). Digested nucleic acids were cleaned with phenol-chloroform extraction and resuspended in nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and microRNAs were isolated by size selection on 6% TBE PAGE gels 1mM (Novex) with clean up performed using Monarch PCR and DNA clean up kit (NEB), according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The DNA with end tags was oxidated by adding 15 μL TET2 reaction mix (6 μL TET2 reaction buffer plus reconstituted TET2 reaction buffer supplement (NEB), 0.6 μL oxidation supplement (NEB) ...
-
bioRxiv - Cancer Biology 2024Quote: ... perform 25-30 separate 100 µL reactions with 6-8 µg genomic DNA in each reaction using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for around 18-20 cycles and then combine the resulting amplicons ...
-
bioRxiv - Cancer Biology 2024Quote: ... C1- and HMG-domain deletion and point-mutant constructs were cloned from pcDNA3.1-HA-CIC::DUX4 (a gift from Takuro Nakamura (6)) using the Q5 Site-Directed Mutagenesis Kit (NEB E0554S) with the primers described in Supplemental Dataset S2 ...
-
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2024Quote: ... of the Oprl1 gene were amplified from a C57BL/6 BAC clone by PCR using Q5 Polymerase (New England Biolabs) and cloned into polylinkers of a targeting construct that contained IRES-mnCre:GFP ...
-
bioRxiv - Cancer Biology 2024Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A fraction (generally 6 µL) of the eluate was mixed with an equal volume of 6x purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were then incubated for 6 h at 37 °C with or without 60 U of RNaseH1 (New England Biolabs) to ensure specificity of the following immunoprecipitation step ...
-
bioRxiv - Microbiology 2024Quote: ... oligonucleotide primers were used to amplify ∼500 bp flanking regions of aur or sspA genes (Supp Table 6) using Q5 polymerase (NEB) and S ...