Labshake search
Citations for New England Biolabs :
601 - 650 of 3324 citations for Ammonium Polyphosphate phase II 02 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733, and BsmBI, New England Biolabs #R0739) were used to iteratively concatenate sequence modules ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA Library was generated using NEB Next Ultra II DNA library kit (NEB, E7645S) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA synthesis was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB). Expression levels of target genes were determined by RT-PCR using SensiMix SYBR No-Rox (Bioline ...
-
bioRxiv - Genomics 2022Quote: ... the fragmented gDNA was end-repaired and dA-tailed (NEB Ultra II E7546 module), then ligated to a custom hairpin adapter using NEB ligase master mix (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (NEB Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (NEB Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA libraries were prepared using NEBNext Ultra II DNA Library Prep Kit (NEB #E7645S), and sequenced by NovaSeq 6000 System.
-
bioRxiv - Cell Biology 2022Quote: 1 μg of total RNA was reverse transcribed with Protoscript II reverse transcriptase (NEB), both according to the manufacturer’s instructions using random hexamer primers ...
-
bioRxiv - Cell Biology 2023Quote: ... and reverse transcription was performed using ProtoScript II reverse transcriptase (New England Biolabs, USA) with oligo dT primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7770). The quality and concentration of libraries were assessed with Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... the NEBNext Ultra II DNA library prep kit (New England Biolabs, Ipswich, MA, USA) was used according to protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... First-strand cDNA was synthesized using a ProtoScript II cDNA first strand kit (NEB) with 1 μg of total RNA ...
-
bioRxiv - Microbiology 2023Quote: cDNA libraries were prepared using a NEBNext Ultra II RNA Library Prep Kit (NEB). RNA and cDNA quality and quantity were evaluated by performing a Qubit assay with the TapeStation 4200 system (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 µg of lysates were deglycosylated using Protein Deglycosylation Mix II (NEB Cat# P6044S). In short ...
-
bioRxiv - Cell Biology 2024Quote: ... pBluescript II KS (+) and ORF were digested using SacI and SalI (New England Biolabs) restriction enzymes according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA libraries were prepared according to the manufacturer’s protocol (NEBNext® Ultra II, NEB). Sequencing was performed on the NovaSeq Illumina) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II Directional kit(NEB, Cat no E7760L) with ribodepletion (Qiagen QIAseq FastSelect -rRNA HMR Kit ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the NEBNext Ultra-II RNA kit (New England Biolabs) according to a previously described protocol27 ...
-
bioRxiv - Genomics 2024Quote: ... The NEBNext® Ultra II Directional RNA Library Prep kit (New England Biolabs, USA) was used for RNA sequencing library construction ...
-
bioRxiv - Genomics 2024Quote: ... we prepared genomic libraries with the NEBNext Ultra FS II kit (New England Biolabs) and resequenced the whole genomes at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Genomics 2024Quote: ... and dual-barcoded using a New England Biolabs Ultra II Directional kit (NEB #E7765). Individually labelled samples were pooled and sequenced using a paired end protocol and a read length of 150bp ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina Nova-seq S4 instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... University of Oxford using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, #E7760) and sequenced on NovaSeq6000_150PE (150 bp paired-end directional reads ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.5 mM dNTPs) and 1 µL of ProtoScript® II Reverse Transcriptase (NEB) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... using NEBNext Ultra II Directional (stranded) RNA Library Prep Kit for Illumina (NEB #E7760L), NEBNext Poly (A ...
-
bioRxiv - Genomics 2024Quote: ... with the NEB Ultra II directional kit (New England Biolabs, Ipswich, Massachusetts, United States). The libraries were then sequenced at a NovaSeq instrument with the SP sequencing kit ...
-
bioRxiv - Genetics 2024Quote: ... we used the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645) instead of the Dovetail kit ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was reverse transcribed using the Protoscript II First Strand cDNA synthesis kit (NEB). qRT-PCR reactions were prepared with 0.5 µM of forward and reverse primers added to cDNA samples and amplification using SYBR Green (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... US) followed by barcode ligation (NEBNext Ultra II Ligation Module, Cat. No. E7595, NEB and Native Barcoding Expansion Kit 1-12/13-24 ...
-
bioRxiv - Immunology 2024Quote: ... and 1X NEBNext Ultra II Q5 Master Mix (New England Biolabs, catalog no. M0544). Reactions were amplified under the following cycling conditions ...
-
bioRxiv - Genomics 2024Quote: ... One reaction of NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645) was used for each gDNA sample ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (NEB, E7645S) and sequenced on an Illumina NovaSeq X (paired-end ...
-
bioRxiv - Microbiology 2024Quote: ... All the restriction enzyme digestion steps were using BsaI type II restriction enzyme (NEB). The Golden gate assembly of the modified pDOC-GG was using primers in Supplementary Table 1 ...
-
bioRxiv - Systems Biology 2024Quote: ... UK using the NEBNext Ultra II RNA Library prep for Illumina kit (NEB#E7760L) NEBNext Poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were prepared using NEBNext Ultra II FS DNA library kit (New England Biolabs) and Illumina (MiSeq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared with the NEB Next II Ultra DNA library kit (NEB, E7645L) using 500 pg DNA input ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (NEB #E7645) and sequenced on an Illumina NextSeq 500 using 75-nucleotide read length paired-end sequencing.
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was produced using a ProtoScript® II Reverse Transcriptase (New England Biolabs) reaction and a Spike-specific reverse primer (5’ CTGAAGGAGTAGCATCCTTG 3’) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNA was digested with Thermolabile USER (Uracil-Specific Excision Reagent) II (NEB, M5508) overnight before alkaline hydrolysis in 1M NaOH at 65°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, E7645L) was used as described previously (56 ...
-
bioRxiv - Microbiology 2024Quote: ... 1µg of total RNA was converted into cDNA with Protoscript II reverse transcriptase (NEB). The PKR open reading frame was amplified with primers PKR-exon2-F and PKR-exon17-R ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) and qPCR performed using iTaq Universal Probes Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... ligation-based library preparation was performed using a NEBNext Ultra II DNA Kit (NEB). The library was then subjected to Illumina NovaSeq paired-end sequencing (150-bp).
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the NEBNext Ultra II RNA Library Prep kit for Illumina (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library was prepared using Ultra II Directional RNA Library Prep Kit (NEB, Cat #E7765) for all samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by NEBNext Ultra II DNA Library Preparation Kit protocol (NEB #E7645L) and analyzed by Agilent 4200 TapeStation ...
-
bioRxiv - Neuroscience 2024Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: The sequencing library was prepared with NEBNext UltraTM II Directional PolyA mRNA kit (NEB) and sequencing was performed on Illumina HiSeq 4000 yielding around 33 million strand specific 75 bp paired-ends reads per sample ...
-
bioRxiv - Microbiology 2024Quote: ... pL6CS-Xu-HDHFR1 were initially digested by Xhol I and Avr II (NEB, USA) restriction enzymes ...