Labshake search
Citations for New England Biolabs :
601 - 650 of 660 citations for 6 Chloro 4 methoxyindole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The left lung lobe was used for histological analysis of tumor development (hematoxylin and eosin) after fixation in 4% formaldehyde (Biolabs, Israel). Right lung lobes were minced and digested with 5 mL digestion buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 mM Tris-Cl pH 7.4, 12 mM MgCl2, 1% NP-40, 0.5 mM DTT, 0.1 mg/ml cycloheximide, 80 U/ml NEB murine RNase inhibitor). Beads were transferred to a fresh tube and immunoprecipitated RNA extracted by incubating beads in buffer RLT (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...
-
bioRxiv - Synthetic Biology 2022Quote: All pLS plasmids listed in Supplementary Table 4 were synthesized as gBlocks by IDT and circularized either by ligation with T4 DNA ligase (New England Biolabs, USA), or ...
-
bioRxiv - Synthetic Biology 2019Quote: The adipic acid biosensing plasmid (JBx_101898) was assembled of 4 DNA parts by NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA): First ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... with a terminal elongation step for 4 min at 72°C employing a proofreading Taq polymerase (Q5 High-Fidelity DNA polymerase, New England Biolabs, Germany). After verification of the amplicon sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genetics 2023Quote: ... 4 µg of DNA in 80 µl reaction were incubated at 37°C for seven minutes and randomly fragmented to 300 bp – 4 kb size products using NEBNext® dsDNA Fragmentase (New England BioLabs) and then cleaned using 0.5x SPRI beads ...
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products were diluted by the addition of 4 mL 1.1× T4 DNA Ligase Reaction Buffer (New England BioLabs® Inc) with 1% Triton X-100 and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNase III-treated samples were pre-incubated with 4 U of RNase III (New England Biolabs, Ipswich, Massachusetts, USA, M0245S) in reaction supplemented by 20 mM MnCl2 at 15 °C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... acidocaldarius DSM 639 wild type using the primers (Eurofins Genomics) listed in supplementary Table 4 employing the Q5 polymerase (NEB, USA) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the purified PCR products were ligated with the empty vectors in a molar ratio of 1:4 using T4 DNA ligase (NEB, USA) at 16 °C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... The cloning reaction consists of 25 cycles of 3 min at 37°C for digestion and 4 min at 16°C for ligation combining the restriction enzymes BsaI-HF (New England BioLabs, Ipswich, UK) for level 1 reaction or BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana IMPa-4 fragment were used for genomic PCR and followed by digestion with BamHI and XhoI (New England Biolabs, Ipswich, MA). The pTRV2 vector (ABRC ...
-
bioRxiv - Neuroscience 2022Quote: ... Supplementary Table 4) from each sample was further processed with the Illumina NEBNext Ultra II Directional RNA Library Prep Kit (NEB #E7760S/L) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... or medium that were pulled down with heparin-agarose (0.5 ml) were denatured and incubated with Arthrobacter ureafaciens sialidase (Nacalai Tesque, 4 milliunits) and/or O-glycosidase (New England BioLabs, 80,000 units), or peptide N-glycanase (PNGase ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were incubated at 16 °C for 4 h in the presence of 1.15x of T4 ligation buffer (New England Biolabs, catalog no. B0202S) and 100U T4 ligase ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was extracted from homogenized cell lysate by 4 × 250 µL/brain Oligo (dT)25 magnetic beads (New England Biolabs, Cat: S1419S), and immunoprecipitated (IP ...
-
bioRxiv - Genomics 2023Quote: ... Illumina libraries for all 4 isolates were constructed using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs Inc., USA) as per standard protocol and sequenced using the Illumina MiSeq and NextSeq500 platforms (paired end ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...