Labshake search
Citations for New England Biolabs :
601 - 650 of 4681 citations for 6 7 Dihydro 2 formyl 5H pyrrolo 1 2 a imidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 5μL of 2× Luna Universal qPCR Master Mix (NEB, MA, USA). The amplification program was set as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of 10x DNase I Buffer (New England Biolabs, #m0303s), 1 μL of rDNase I (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μM of adapter and 2 μL of Quick ligase (NEB) for 20 minutes at 23°C in 40 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... For nucleosomes labeling reaction mix contained: NEBuffer™ 2 (NEB B7202), protease and HDAC inhibitors (as detailed above) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µL NEBNext HiFi 2× PCR Master Mix (New England BioLabs) was added to the DNA mixture ...
-
bioRxiv - Genomics 2023Quote: ... a hybridization reaction was carried out in 1X Buffer 2 (NEB). 10 µM pool of designed oligomers and 10 µM of a complementary-overlap-containing-oligomer were first denatured at 95°C for 15 seconds and allowed to hybridize at 43°C for 5min ...
-
bioRxiv - Genomics 2023Quote: ... 0.3 μg DNA was digested with 2 U DpnI (NEB R0176S) or 5 U MboI (NEB R0147S ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were first incubated with Deglycosylation Mix Buffer 2 (NEB) at 75°C for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... A-tailing was done with 1X NEBuffer 2 (New England Biolabs), 0.2 mM dATP ...
-
bioRxiv - Genomics 2024Quote: ... 2.5 μl of DTT and 2 μl of Blunting Enzyme (NEB) in a total reaction volume of 50 μl ...
-
bioRxiv - Genomics 2024Quote: ... the reaction is treated with 2 μl of Proteinase K (NEB). The digestion is carried on at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 20 µL of 2% BSA (New England Biolabs, catalog no. B9000S), and 1.86 mL of nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µg/µL of Proteinase K (New England Biolabs, #P8107S), was prepared and loaded into a 3 mL syringe (BD Biosciences ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM DTT) and a wash with 10 μL streptavidin (NEB). The chamber was further washed with 10 μL TIRF buffer followed by a 1-minute incubation with 2 μL of microtubules diluted in 8 μL TIRF buffer supplemented with 50 mM KCl and 1.25 mg/mL casein (TIRF-Casein) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Master mix was added to each sample together with 1 µl truncated T4 RNA Ligase 2 (#M0239, NEB; Frankfurt/Main, Germany). Ligation was carried out for 2 h at 23°C and nucleic acids were precipitated ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: cDNA was reverse-transcribed from donor 1 and donor 2 RNA samples using the ProtoScript II first strand cDNA synthesis kit (NEB #E6560) with oligo dT priming ...
-
bioRxiv - Pathology 2019Quote: ... protocol using the PCR Barcoding Expansion 1-12 (EXP-PBC001) kit (ONT) and LongAmp Taq 2× Master Mix (New England Biolabs, MA) with the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... was linerized by inverse PCR with primers 13 and 14 and the duplex oligo was ligated to the linearized plasmid in a 2:1 insert:vector molar ratio using NEBuilder Hifi Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 and 2) and NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library quantification was performed by real-time PCR using the KAPA Library Quantification Kit - Illumina Platforms - Complete kit (Universal ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5XSSC in H2O) on a light table for 1 hour and treated with 2 μg/mL Protease K (NEB, Cat PB107S) in PBS containing 0.3% Triton-X for 10 minutes followed by post-fixation in 4% PFA for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 μg of λ-phage DNA was mixed with two oligos (2 μM oligo Lab07 (/5Phos/AGG TCG CCG CCC/3BioTEG) and 2 μM oligo Lab06 (/5Phos/GGG CGG CGA CCT/3BioTEG) in 1× T4 DNA ligase reaction buffer (NEB B0202S) and heated to 70°C for 15 min followed by gradual cooling to 15°C for 2 hours ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...