Labshake search
Citations for New England Biolabs :
601 - 650 of 731 citations for 4 4' Di N acetylamino diphenylsulfone d8 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Genetics 2023Quote: N-terminal GST-fusion TF DBD proteins were expressed using the PURExpress in vitro transcription/translation kit (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: The recombinant pET6xHN-N constructs were transformed into Escherichia coli strain BL21(DE3) (New England Biolabs, MA, USA). The transformed clones were cultured at 37 °C in LB medium with 100 μg/mL Carbenicillin and were induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2024Quote: ... and then constructed the library using NEBNext® Ultra™ II for DNA kit (NEB; P/N E7645L). We used the Agilent Bioanalyzer to assess the quality of the library and a qPCR approach with the KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Biochemistry 2023Quote: Removal of N-linked oligosaccharides in mini-procollagens was performed with PNGase F (New England BioLabs, glycerol-free). Ten micrograms of mini-procollagens were first denatured at 100 °C for 10 min in Glycoprotein Denaturing Buffer provided with the enzyme ...
-
bioRxiv - Cell Biology 2024Quote: ... The lysates were then treated with 500 U of peptide-N-glycosidase F (PNGase F; P0704L, NE BioLabs) in a reaction solution containing 50 mM sodium phosphate (pH 7.5 ...
-
bioRxiv - Physiology 2024Quote: ... a separate set of lysates was treated with Peptide-N-Glycosidase F (PNGase F; New England BioLabs, #P0704) according to the manufacturer’s recommendations and blotted as shown in Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... addition of a N-terminal Hemagglutinin (HA) epitope was done using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) following manufacturer recommendations.
-
bioRxiv - Genomics 2020Quote: ... libraries were quantified by qPCR using either the NEBNext® Library Quant kit (New England Biolabs, Cat. N: E7630S) or the KAPA Library Quantification Kit (scRNA-seq libraries only ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified on the streptavidin beads using the EpiMark Hot Start Taq (New England Biolabs, Cat. N: M0490) using following program ...
-
bioRxiv - Biochemistry 2020Quote: ... Glycans were incubated with different exoglycosidases in different sequences: (i) Streptococcus pneumonia β-N-acetylglucosaminidase (GUH, New England Biolabs); (ii ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Biophysics 2021Quote: ... 3 mM CaCl2 and 0.02% DDM) was incubated with 2000 units of N-glycosidase F (PNGase F) (New England BioLabs) at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The Cas9/gRNA expression construct pTREX-n-Cas9 was first modified using the Q5 mutagenesis kit (NEB, Ipswich, Massachusetts), primers 5’-CCCAAAAAGAAAAGGAAGGTTGATTAGAAGCTTATCGATACCGTCGAC-3’ and 5’-GTCCTCGACTTTTCGCTTCTTTTTCGGGTCGCCTCCCAGCTGAGA-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... PCR analysis of total DNA extracted from oysters (N=60) used the high fidelity Q5 polymerase (New England Biolabs) in a total volume of 50 μL under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Plant Biology 2024Quote: ... and SLAC1 cDNAs (N-terminal or C-terminal) were cloned in-frame into pMAL-c5X vector (New England Biolabs) using In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Microbiology 2024Quote: The CrsL-6xHis (at its N-terminus) was generated by PCR cloning using Q5 High-Fidelity DNA Polymerase (NEB) with primers #4539 + #4540 and M ...
-
bioRxiv - Biochemistry 2024Quote: ... a vector containing an N-terminal Thioredoxin-His10 tag using a Gibson Assembly® Cloning Kit (New England BioLabs). Plasmids were extracted and transformed into competent E ...
-
bioRxiv - Cell Biology 2020Quote: ... photoactivatable-mCherry was PCR-amplified from the plasmid N-PA-mCh and assembled into the retroviral vector pBABE-puro using HiFi DNA Assembly (E5520S, NEB). To create the stable U2OS-dCas9-PA-mCh/GFP-Parkin and U2OS-dCas9-PA-mCh/TFEB-GFP cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... The amplicons were cloned into PCR-linearized pPR3-N prey plasmid (Dualsystems Biotech) at the SfiI sites using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs), and were transformed into DH5α competent cells and plated onto 48-well Bioassay Qtrays (Molecular Devices) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... A 12xHis tag was cloned into the N-terminus of pcDNA3.1-MICAL1-FLAG using Q5® Site-Directed Mutagenesis Kits (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: AcpP was expressed from a pET28a plasmid encoding acpP with a thrombin-cleavable N-terminal 6xHis tag in C3031I cells (NEB). 2L cultures of LB supplemented with kanamycin (25 μg/mL ...
-
bioRxiv - Biochemistry 2020Quote: 20 μg of protein from SK-RC-39 cells were treated with N-glycosidase F (PNGase F) and Endoglycosidase H (Endo H) (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Engineered SiR vectors carrying d.C1349G or d.G1357T PEST-targeting mutations were produced by PCR amplification of the Rabies genome in 2 fragments starting from the end of N assembled using Gibson master mix (NEB).
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the pZE13d vector (Lutz and Bujard, 1997) with an N-terminal 6xHis tag via Gibson assembly (Hifi DNA Assembly, NEB) using ClaI and PstI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... open reading frames were cloned into a linearized pET28b vector with BamH1 and Xho1 in frame with a N- terminal 6x-His tag using Gibson HiFi assembly mix (NEB), 10 μL total reaction volume with 2 μL of linearized vector ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The exact same purification scheme for DDX5(1-535)-SNAP was used to purify DDX5(1-483)-SNAP and the protein was flash frozen in medium salt storage buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). E ...