Labshake search
Citations for New England Biolabs :
601 - 650 of 6227 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Plasmid DNAs for each of the 4 constructs were sequentially digested with SacI and BamHI (New England Biolabs, Ipswich, MA), purified by gel electrophoresis ...
-
bioRxiv - Biophysics 2023Quote: ... the mixtures were deproteinized by adding pronase E (4 μg/μl) and 1X purple gel loading dye (New England BioLabs) and incubated at 55°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: G4tr (UUAGGG)4 and G4mt (UUACCG)4 were prepared using an in vitro the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... pH = 8 for 16 hours at 56°C followed by 30 minutes at 90°C and an additional digest of 4 units of beta-agarase (M0392S, New England BioLabs) for 1 hour at 65°C to ensure full agarose breakdown ...
-
bioRxiv - Neuroscience 2024Quote: ... a 92-repeat sequence was isolated from a previously verified in-house construct with NheI and NotI restriction digests and subcloned into the MCS of pCDH-EF1-C9up-MCS-C9down-IRES-copGFP with overnight ligation at 4°C (T4 ligase, NEB). To maintain repeat stability ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 30 min and then at 60 V (∼4 V/cm) until the pink loading dye was reached in 6x gel loading dye (B7025S, New England Biolabs), which shows a similar migration speed to that of bromophenol blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples then underwent two separate digestion reactions (with up to 4 µg of genomic DNA) using NlaIII and MseI enzymes (NEB) at 37°C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... The new SNAP-tagged histones synthesized during the chase were fluorescently labelled with 4 μM of the green-fluorescent reagent SNAP-cell Oregon green (New England Biolabs) during a 15-min pulse step followed by 30-min wash in fresh medium ...
-
bioRxiv - Genomics 2022Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 μL of 10X CutSmart buffer (New England Biolabs), 60 μM of lab-made synthetic AdoYnATTO643 (see synthesis in the Supplementary Data) ...
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Genetics 2022Quote: ... or three (for cloning 4 sgRNAs) fragments were ligated in an equimolar ratio in a Golden Gate reaction with T4 ligase (New England Biolabs) and the BsmBI isoschizomer Esp3I (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... was PCR amplified (495bp) and cloned into the Lucia vector (Supplementary Figure 4) using ApaI and BamHI restriction enzymes (NEB, Catalog no ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from ∼4 million N2A cells and fragmented with restriction enzymes (BsrGI, EcoRI, HindIII, SspI, XbaI, 30 U/each, NEB) following a published protocol (89) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and size selected by running samples on a 1.8% LMT agarose gel at 120 V for 25 minutes at 4°C and gel extracting the mononucleosome band with a Monarch Gel Extraction Kit (T1020S, New England Biolabs). Purified samples were carried forward for qPCR or library preparation ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The target genomic locus was amplified with the primers listed in Supplementary Table 4 using the Q5 Hot Start High-Fidelity Polymerase (NEB). Editing frequencies were assessed by T7E1 assay or targeted amplicon sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... The beads were washed three times with PNK wash buffer and the RNA-protein complexes labeled with 32P with the following reaction: 4 μl 10X PNK buffer (NEB), 2 μl T4 PNK enzyme ...
-
bioRxiv - Genomics 2024Quote: ... samples between 4 and 24 mol/µl were amplified by selective whole genome amplification (sWGA) using the enzyme phi29 DNA Polymerase (NEB) before the genotyping ...
-
bioRxiv - Biochemistry 2024Quote: ... Ig3-4 was purified using the same method as Ig3/Ig4 with the addition of an amylose column (New England Biolabs) chromatography step to remove the MBP tag prior to cation exchange ...
-
bioRxiv - Biochemistry 2024Quote: ... was incubated in a reaction volume of 50 µl at 37°C for 18 h with 10 U of T4 beta-glucosyltransferase (T4-BGT) in the presence of 80 µM UDP-glucose in NEBuffer 4 (all New England Biolabs). Control reactions were incubated without T4 beta-glucosyltransferase ...
-
bioRxiv - Genomics 2024Quote: The efficacy of the methylation protocol was verified by methylation of a control library (CL) (Table 4) followed by enzymatic digestion using BstBI (NEB). 1 μg of both modified and unmodified CLs were mixed with 1 μl enzyme ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted at 7200rpm for 2min at 4℃ and washed once with cold 1.4× NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4× NEB buffer 3.1 containing 0.1% SDS and incubated at 65℃ for 10min ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole brains were blocked at RT for 1 h in PBT containing 0.5% BSA and 5% NGS (PBANG) and then incubated in PBANG containing rabbit anti-GFP (1:100; Torry Pines Biolabs, TP401) at 4°C for 2 nights ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:50,000 (NEB, and anti-GST HRP conjugates ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 uL RNase A and 1 uL ProtK all from the Monarch gDNA extraction kit (NEB, T3010). gDNA was extracted following the extraction kit’s protocol with the exception that 600 uL of gDNA binding buffer were added to 400 uL quenched reaction and added to the extraction column on two spins of 2 minutes at 1000g ...
-
bioRxiv - Molecular Biology 2023Quote: ... The insert was ligated to the vector in a 3:1 ratio (insert:vector) using T4 ligase (NEB). This introduced C-terminal 6xHis tag to Syn0852 ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3′ RNA adapter was ligated to the purified RNAs using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Microbiology 2020Quote: ... followed 1 hr recovery in 1 mL pre-warmed SOC (NEB) at 37°C 250 rpm ...
-
bioRxiv - Biophysics 2021Quote: ... The chamber was incubated with 1 mg ml−1 streptavidin (NEB) and washed with MBCT ...