Labshake search
Citations for New England Biolabs :
6251 - 6300 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... in 57 ml using end repair buffer from NEBNext Ultra II DNA library preparation kit for Illumina (NEB). Glucosylated DNA was then end repaired without purification followed by ligation to Pyrrolo-dC adaptors as indicated in NEBNext Ultra II DNA library preparation protocol (NEB ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) using 1 µg DNA ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Amplicons were processed for sequencing using the NEBNext Illumina library preparation kit (New England Biolabs, Whitby, ON, Canada) and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the RNA sample was used as input for an NEBNext Small RNA Library Prep for Illumina kit (NEB). Barcoded amplicons were sequenced on a MiSeq (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were assembled using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) with NEBNext Multiplex Oligos for Illumina primer sets (NEB #E7335 and #E7500) ...
-
bioRxiv - Immunology 2021Quote: ... the RNA sequence library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs). Paired-end sequencing was performed with NextSeq500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: An Illumina sequencing library was also prepared using a NebNext Ultra DNA II Kit (New England Biolabs, USA). The library was sequenced on a HiSeq X10 (150bp paired end reads ...
-
bioRxiv - Plant Biology 2020Quote: ... Sequencing libraries were generated using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (NEB, USA). Clustering of index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 500 ng of gel purified mononucleosomal DNA were repaired using the PreCR Repair Mix Kit (New England Biolabs) with 100 µM dNTPs in a 50 µL reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... sequencing libraries were generated using NEBNext®Ultra™RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... The Myc-tagged Nix-S212A and Nix-S212D were generated using a Q5 mutagenesis kit (New England Biolabs). The lentiviral shNix (Addgene #100770 ...
-
bioRxiv - Cell Biology 2021Quote: ... and PCR amplification were performed using the Truseq Small RNA Sample Prep Kit for Illumina (NewEngland Biolabs, E7335S) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and then used for in vitro transcription with the HiScribe T7 ARCA mRNA Kit (with tailing, NEB, E2060S). Transcription products were purified using RNAse-free SPRI beads ...
-
bioRxiv - Biochemistry 2020Quote: Total RNA was extracted from HLCs using the Monarch® Total RNA Miniprep Kit (New England BioLabs, T2010). RNA integrity was assessed using a Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... were amplified by PCR and cloned into the pX601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... The product was cloned into a pSB3K3 vector using either NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) or the MEGAWHOP protocol54 based on a plasmid carrying the inactive variant E418A ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed in vitro transcription using the HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs), and purified the resulting RNA using a GeneJET RNA Purification Kit (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... In vitro transcription was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs (NEB)) as previously described (23) ...
-
bioRxiv - Bioengineering 2020Quote: ... In vitro transcription was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs (NEB)) as previously described (23) ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA was immediately purified using a DNA cleanup column (the Monarch PCR & DNA cleanup kit from NEB) and eluted with water ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were generated using NEBNext®Ultra™RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit (#E7420, New England BioLabs) for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645L) following manufacturer’s instructions and NEB Next Multiplex Oligos for Illumina (96 Index Primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared using NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing libraries were prepared with NEBNext® UltraTM II kit for Illumina (cat# E7645S) (New England Biolabs, MA) and exomes were captured with SSELXT Human All exon V6 +UTR probes (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... an NLS sequence was inserted downstream of the TagRFP sequence in the Cb expression vector described above with primers nls-insert_for and nls-insert_rev using the Q5 Site-Directed Mutagenesis Kit (NEB) and the resulting plasmid was used as a template to subsequently amplify the TagRFP-NLS sequence using the primers frag3-tRFP-nls_for and frag3-tRFP-nls_rev ...
-
bioRxiv - Plant Biology 2021Quote: ... The K107E and ΔSTART mutations in PDF2 were generated using Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The L480P mutation in GL2 was generated by one-step PCR-based site-directed mutagenesis (Scott et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted using Monarch Total RNA Miniprep kit including DNAse treatment on column (New England Biolabs). m7G-RIP was then performed as previously described49 with slight modifications ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Microbiology 2020Quote: ... Catalytically inactive Mt2 (Mt2 C78A) variant was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit) using primers listed in the primer table (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were created using NEBNext® Ultra(tm) Directional RNA Library Prep Kit (New England BioLabs, Frankfurt, Germany). Pooled libraries were loaded on the cBot (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries were prepared using the NEB Next Ultra DNA Library Prep kit for Illumina (New England BioLabs). Approximately 10 Gb were sequenced with a HiSeq X Ten instrument as paired-end 150 bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs were synthesized from RNA using the LunaScript™ RT SuperMix Kit from New England BioLabs (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... then RNA-seq libraries were prepared using the NEBNext Ultra II Directional mRNA-seq kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... Ribo-depleted RNA was then prepared for sequencing using the NEBNext Ultra Directional RNA kit (NEB product E7420), and sequenced as described above for the DNA samples.
-
bioRxiv - Cancer Biology 2020Quote: ... site-directed mutagenesis was carried out using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat# E0554S) to introduce a stop codon ...
-
bioRxiv - Plant Biology 2021Quote: ... the mutations were generated in pBridge-PIF3-N1 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The primers used to generate the m1 to m15 mutants are listed in Supplementary Table 2 ...
-
bioRxiv - Systems Biology 2020Quote: ... The NCK2 SH3 shuffled chimeras were constructed using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Inc). The different functional regions of NCK2 are based on NCBI (NP_035009.3 ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA sequencing libraries were created using the NEBNext Ultra II Directional RNA-Seq library kit (NEB, Ipswich, MA) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... The mutants DSR2 (N133A) and DSR2 (H171A) were constructed using the Q5 Site-directed Mutagenesis kit (NEB, E0554S) using eaither primers JG216 and JG217 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by library preparation with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed as 100 bp single read sequencing on HiSeq2500™ (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... and domain-swapped chimeras were generated with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 1μg of linearised plasmids using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs). Single-end sequencing (75 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA transcripts were expressed using the NEB HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Australia).