Labshake search
Citations for New England Biolabs :
6251 - 6300 of 6874 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 40 μl 50% PEG 8000 for 1 hour at room temperature then incubated overnight at 25°C in 100 μl 1x T4 RNA ligase buffer (NEB) containing 40 μl 50% PEG 8000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PEARL extracts from cultured cells were treated with either DNase I (1 unit per every 8 μL of PEARL extract, New England BioLabs) or with RNase A (0.1 mg per every 8 μL of PEARL extract ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL RNA was mixed with 2 μL of 100 μM PvG748-SBS12-RT random hexamer primer (IDT) and 1 μL of 10 mM dNTP mix (NEB). The sample was incubated for 3 min at 65 °C and transferred to ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13.5 μL digestion reaction product was combined with 1.5 μL second-strand synthesis (SSS) buffer and 1 μL of SSS enzyme mix from the NEBNext mRNA Second Strand Synthesis Module (NEB) and incubated at 16 °C for 2.5 h ...
-
bioRxiv - Molecular Biology 2020Quote: In vitro cleavage assay with the purified AsCas12a and SpCas9 nucleases was carried out in a volume of 30 µL in 1× NEB2.1 buffer (New England Biolabs Inc.). The standard reaction containing 10 nM of PCR-obtained DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB, 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Cell Biology 2022Quote: SDS-PAGE and Western blot analysis were performed as previously described (Alpy et al, 2005) using the following antibodies: rabbit anti-GFP (1:2000; TP401, Torrey Pine Biolabs), rabbit anti-MOSPD2 (1:250 ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragments were circularized in a dilute mixture of 1ng/μL DNA in T4 DNA ligase buffer with 1 cohesive end unit/μL T4 DNA ligase (New England Biolabs) for 16 hours at 16ºC ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 200 ul of intra-aggragete mix (171 ul water, 1 ul 100 mM ATP, 20 ul 10x NEB T4 DNA Ligase Buffer ...
-
bioRxiv - Genomics 2020Quote: ... PCR reactions were performed in 50 μl volumes with 1 ng pFA-MNase plasmid and the Q5 high fidelity polymerase (New England Biolabs). PCR thermocycling was executed as following ...
-
bioRxiv - Genomics 2020Quote: ... Irradiated and control DNA was either loaded directly on a 1% agarose gel or incubated with T4 endonuclease V (New England Biolabs) for 30 minutes at 37°C and subsequently analyzed by agarose gel electrophoresis using a 1% agarose gel.
-
bioRxiv - Genetics 2019Quote: ... 2011) (Table S2-S3) were ligated to the digested DNA with 1 U of T4 DNA ligase (New England Biolabs) in 50 μl of reaction volume at 16°C for 5 h and inactivated at 65°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... were used in combination with mutation primers (Table 1) to generate overlapped PCR fragments (Phusion High-Fidelity DNA Polymerase, NEB), with disrupted RNA structure at each selected PAR-CL sites ...
-
bioRxiv - Genomics 2019Quote: ... we digested each sample with the restriction enzymes SphI-HF and MluCI for 1 hour at 37°C (New England Biolabs). These enzymes were chosen because they are insensitive to DNA methylation (and therefore will not show biased template enrichment ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transcriptional units were amplified directly from the golden gate mixture using 1 µL of reaction mixture as template in 50 µL Q5 Hot-Start Master Mix reactions (NEB). PCR reactions were performed according to manufacturer’s instructions and cleaned up using clean and concentrate kits (D4004-Zymo Research) ...
-
bioRxiv - Molecular Biology 2019Quote: ... all reactions using capped 25mer RNA substrates were terminated by the addition of 1 volume of 2X RNA loading dye (NEB). The reactions using the m7GpppA dinucleotide cap analog were terminated with the addition of phenol/chloroform.
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was carried out by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutation (Table 1) followed by DpnI (NEB) treatment ...
-
bioRxiv - Microbiology 2019Quote: ... the 11.4 kb fragments of GPV- or HIV- GPP were joined with their cognate 304 bp zip coded partial U3 inserts via Gibson Assembly in a molar ratio of 1:5 per reaction using HiFi DNA assembly mix (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Molecular Biology 2019Quote: Messenger RNA (mRNA) was enriched from 1 μg of total RNA by Poly(A) mRNA Magnetic Isolation Module (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A PCR reaction adding a T7 promoter/terminator pair on each aptamer (see Table 1) was carried out using Q5 High-Fidelity DNA Polymerase (New England Biolabs Inc.(NEB) #M0491 ...
-
bioRxiv - Genomics 2019Quote: ... diluted to 100 ng/µL and blunted using 1 U/µg mung bean nuclease under the appropriate buffer conditions (New England Biolabs). The DNA fragments of 150–200 bp length were gel-extracted on 3% NuSieve 3:1 Agarose (Lonza) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the bar-1 locus was genotyped for successful co-conversion by PCR amplification with OneTaq polymerase (New England Biolabs) using primers that annealed to the genomic DNA surrounding the insertion point ...
-
bioRxiv - Genomics 2019Quote: ... 20 U RNasin Ribonuclease inhibitor and 1× protease inhibitor mix) and further treated with 100 U of DNase I (NEB) for 20 min on ice ...
-
bioRxiv - Genomics 2019Quote: ... The supernatant was carefully removed and nuclei were resuspended in 100 μl of DNase digestion buffer (1× DNase buffer (NEB), 25 µM α-amanitin ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Genetics 2019Quote: ... The reaction was incubated at 50°C for 1 hour and the remaining RNA was degraded by RNase H (NEB) and RNase A (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... universal adaptors were ligated to the A-tailed DNA fragments at room temperature for 1 h with T4 DNA ligase (New England Biolabs) and amplified with Illumina barcoded primers using KAPA SYBR FAST qPCR Master Mix for 5∼12 PCR cycles to obtain enough DNA for sequencing ...
-
bioRxiv - Bioengineering 2019Quote: ... pneumoniae chromosomes are incubated overnight at 37°C in presence of 1 µL of Cas9 Nuclease from Streptococcus pyogenes (M0386T, NEB) and 21 µg of gRNA transcripts produced by in vitro transcription of oligonucleotides (HiScribeTM T7 High Yield RNA Synthesis kit from NEB) ...
-
bioRxiv - Genomics 2019Quote: ... solution was diluted 1:20 and 5 μL used in a standard 50 μL PCR reaction using Q5 enzyme (NEB). PCR products were Sanger sequenced and analyzed using SnapGene to identify SNP corrected clones (7/192) ...
-
bioRxiv - Biophysics 2019Quote: ... Both the 2 kb spacer and 1.5 kb biotin handle DNA were ligated to 5’-CGGT 1 µm polystyrene oligo beads overnight at 16 °C using T4 DNA ligase (NEB). The ligated beads were first washed with TE + 0.5 M KCl + 20 µg/mL β-casein ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic regions of about 1 kb were amplified from wild-type genomic lysates using Q5 Hot Start high-fidelity polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... a ~200 bp amplicon was generated from 1×106 template molecules by PCR in 22 cycles using Phusion polymerase (NEB), purified with the QIAquick gel extraction kit ...
-
bioRxiv - Biochemistry 2020Quote: ... The region harboring the randomized hexamer and flanking constant tags was amplified from 1 µg ssDNA for 5 cycles using the Q5 Hot Start High-Fidelity PCR Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Genetics 2021Quote: ... Ligation was performed in a total volume of 20 μl by the addition of 1 μl T4 DNA Ligase (400 Units, NEB) in 1X T4 DNA Ligase buffer (NEB ...
-
bioRxiv - Genomics 2021Quote: ... and on the other side a primer that targets a region introduced through the library preparation called “Read 1” (18 cycles using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) ...
-
bioRxiv - Genomics 2019Quote: ... 1 to 10 ng of gel-purified retrozyme RNA were ligated using RtcB ligase in its corresponding buffer for 1 h at 37 °C (New England Biolabs). Best results for self-ligation assays were obtained with 1 to 10 ng of gel-purified retrozyme RNA in 50 mM Tris–HCl ...
-
bioRxiv - Immunology 2021Quote: ... EtAMA1 and EtIMP1 coding sequences (codon-optimised for yeast) were excised from the constructs generated in study 1 by restriction digest with BamHI and NotI (New England Biolabs). Cloning of the untagged EtAMA1 and EtIMP1 coding sequences into pYD1 was then performed as described for study 1.
-
bioRxiv - Cell Biology 2021Quote: One plug per sample was melted at 68°C in 1 mL 100 mM MES buffer pH 6.5 prior to addition of β-agarase (New England Biolabs) and incubation overnight at 42°C ...
-
bioRxiv - Microbiology 2021Quote: ... Primers listed in supplemental table 1 were annealed and ligated into the digested plasmid using T4 ligase (New England Biolabs). For the generation of pGRA1.GFP.GRA2.DHFR ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’ homologous arm was amplified through overlap extension: Fragment 1 was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs) with primers- clk-5’-Fragment1-F and clk-5’-Fragment1-R (listed in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... were reconstituted by mixing 1 µl of 100 µM stocks of the forward and reverse strands for each guide with 1 µl of 10x ligation buffer (NEB), 0.5 µl T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Systems Biology 2020Quote: ... We neutralized the tagmentation activity of Enzyme 1 by immediately cleaning the reaction with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...