Labshake search
Citations for New England Biolabs :
5951 - 6000 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR products were purified using the Monarch® PCR & DNA Cleanup Kit (NEB, T1030) and used as “megaprimers” that are denatured and annealed to the original plasmid (pNG93 ...
-
bioRxiv - Genomics 2023Quote: ... and sequencing libraries were prepared using the NEBNext Ultra II DNA library kit (New England Biolabs). Samples were sequenced using a paired-end strategy on a NextSeq500 instrument (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... to remove residual plasmid DNA and then purified using Monarch RNA cleanup kit (New England Biolabs). RNA was reverse transcribed using SuperScript IV (Invitrogen Life Technologies ...
-
bioRxiv - Pathology 2023Quote: ... Isolated small RNAs were subjected for library cloning using the Next Small RNA Prep kit (NEB) and sequenced on an Illumina NextSeq 2000 platform ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated using the NEBNext Ultra II DNA library prep kit (New England Biolabs E7645S) with 14 PCR cycles using unique dual indexes (New England Biolabs E6440S) ...
-
bioRxiv - Immunology 2023Quote: Reverse transcriptase qPCR was performed using Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006L). The following predesigned primers and probe sets for each target and the housekeeping gene GAPDH were purchased from IDT:
-
bioRxiv - Evolutionary Biology 2023Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep Kit (New England Biolabs), employing on-column digestion of residual DNA by DNAseI treatment ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA purification was performed with the Monarch PCR & DNA Cleanup kit (New England Biolabs, Ipswich, MA), or the DNA Clean & Concentrator Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2023Quote: ... Single point mutations were introduced by quick- change site directed mutagenesis (Q5-SDM kit (E0554, NEB)) ...
-
bioRxiv - Genomics 2023Quote: ... ChIP-seq libraries were prepared using the NEBNext Ultra II DNA kit (New England Biolabs, E7645S) using up to 50 ng of input or ChIP DNA ...
-
bioRxiv - Genomics 2023Quote: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced as 40 bp paired-end reads on Illumina NextSeq 500 platform.
-
bioRxiv - Immunology 2023Quote: The mRNAs used in this study were produced using HiScribe T7 mRNA synthesis kit (NEB, Australia) using linearized DNA produced by PCR amplification ...
-
bioRxiv - Cancer Biology 2023Quote: ... [32P]-labelled AdML pre-mRNA was synthesized in vitro using the T7 HiScribe Transcription Kit (NEB) using [α-32P] UTP (Perkin Elmer ...
-
bioRxiv - Genetics 2023Quote: ... Illumina libraries were generated using the NEBNext Ultra II Dna Library Prep Kit for Illumina (NEB), as described previously49 ...
-
bioRxiv - Genetics 2023Quote: ... CBX1 mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs Inc., E0554S) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation ...
-
bioRxiv - Genomics 2022Quote: ... RNA was harvested 72 hours after transfection using the Monarch Total RNA Miniprep Kit (NEB #T2010). mScarlet and HPRT (housekeeping gene for normalization ...
-
bioRxiv - Genomics 2022Quote: ... NEBNext® UltraTM II Directional RNA Library Prep Kit for Illumina® (E7760S, New England Biolabs) and NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (E7645S ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was completed using NEBNext Ultra II Directional RNA Library Prep kits (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645S) with NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and the pooled library was further quantified using a NEBNext Library Quant Kit (New England Biolabs). The RNA-seq libraries were subjected to two rounds of 75bp paired end sequencing on a NextSeq 550 platform using a 150-cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... and the pooled library was further quantified using a NEBNext Library Quant Kit (New England Biolabs). The CUT&Tag libraries were subjected to 50bp paired end sequencing on a NextSeq 2000 platform using a P2 100-cycle kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared using NEBNext Ultra II DNA library prep Kit for Illumina (NEB #E7645S) according to the manufacturer’s instructions for MNase ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) to produce stranded cDNA libraries ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA library preparation using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB), and sequencing was performed at the Yale Stem Cell Center Genomics Core facility ...
-
bioRxiv - Cell Biology 2023Quote: Amplified ssDNA library was purified with the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For this ...
-
bioRxiv - Cell Biology 2023Quote: In vitro transcription was done using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB), following the manufacturer’s instructions for short transcripts ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II DNA library preparation kit (New England Biolabs, E7645L), quantified by Qubit fluorimetry ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs) and sequenced on Illumina NextSeq500 (75 bp in single-end mode ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs) and sequenced on Illumina NextSeq500 platform (75 bp in single-end mode).
-
bioRxiv - Neuroscience 2023Quote: ... and HEK-293 cells were extracted using Monarch Total RNA Miniprep Kit (New England BioLabs, T2010S). To prepare RNA-Seq libraries ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was synthesised using T7 RNA polymerase (HiScribe T7 High Yield RNA Synthesis Kit, NEB, E2040S). Then RNA was reverse- transcribed using a recombinant Moloney leukemia virus reverse transcriptase (GeneAce cDNA Synthesis Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed using the OneTaq One-Step RT-PCR Kit (New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... H259A and H353A were cloned using site directed mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) using primers TCATACAGCAGCGGTCCAGTTAC (forward ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and cloned into pUC19 (digested with EcoRI plus HindIII) using the NEBuilder kit (New England Biolabs). The cloning products were then transformed into E ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... The library was generated with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB; 7770), and sequencing was done using the NovaSeq 6000 S4 platform with PE150 ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were constructed using the NEBNext II directional RNA library kit for Illumina sequencing (NEB) and sequenced on a NextSeq2000 platform at the Epitranscriptomics and RNA-sequencing facility ...
-
bioRxiv - Neuroscience 2023Quote: ... single histidine point mutations were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs) with DNA oligonucleotides incorporating the mutation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sik3 and Lkb1 were cloned into pXPR-RFP-Blast using the Gibson Assembly Kit (E2611L, NEB). The target sequences are as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... total RNA isolation was performed by using the Monarch Total RNA Miniprep Kit (New England BioLabs) and RNA concentration was detected in a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2021.9 All three fragments were cloned via Gibson assembly using a HiFi DNA assembly kit (NEB) into a vector backbone containing PiggyBac transposition sites.35 The Cer1:H2B-Venus reporter construct was co-transfected with CAG-pBASE35 using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was derived from total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S). Numerous primers were designed against cryptic exon targets and screened to identify primer pairs that minimized background bands.
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... va mtSSB ΔMTS by PCR amplification and ligation (Q5 Site-Directed Mutagenesis Kit, NEB, Cat #E0554). The plasmid insert was sequence-verified and then transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... The libraries were quantified using the NEBNext Library Quant Kit for Illumina (#E7630; New England Biolabs) based on the mean insert size provided by the Bioanalyzer ...
-
bioRxiv - Neuroscience 2023Quote: ... We quantified the libraries using the NEBNext Library Quant Kit for Illumina (New England Biolabs, #E7630) based on the mean insert size provided by the Bioanalyzer ...