Labshake search
Citations for New England Biolabs :
551 - 600 of 10000+ citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 1 WFIKKN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The polyA containing RNA was then fragmented with fragmentation buffer (NEB)and first strand cDNA was synthesized using random hexamers and M-MuLV Reverse Transcriptase (RNase H-) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37°C and cDNAs were amplified with KAPA HiFi Hotstart Ready Mix (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Genetics 2019Quote: ... each containing 25 µl 2x LongAmp Taq Master Mix (M0287, NEB), 3 µl cDNA PRM primer (cPRM ...
-
bioRxiv - Microbiology 2021Quote: ... in 20μL of reaction mixture containing 1x NEB3 buffer (NEB, USA) and 1u/μL RNasin RNase Inhibitor (Promega ...
-
bioRxiv - Immunology 2021Quote: ... a mix containing 2 μl of RNAse H (NEB, Cat. #M0297S), 1 μl of E ...
-
bioRxiv - Biochemistry 2021Quote: A reaction master mix containing 1X T4 DNA Ligase Buffer (NEB) (2.5 μl/sample volume of 10X T4 DNA Ligase Buffer) ...
-
bioRxiv - Neuroscience 2021Quote: ... Digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) was applied to gels and allowed to digest for 2-16 hours (see Results ...
-
bioRxiv - Neuroscience 2020Quote: ... and sorted directly into lysis buffer containing RNAse inhibitor (NEB E6420). cDNA libraries were made from RNA using NEB’s Next Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB E6420) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37℃ and were finally washed once with 0.1x SSC buffer.
-
bioRxiv - Plant Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 3 hours at 37 °C and were finally washed once with 0.1x SSC buffer ...
-
bioRxiv - Genetics 2021Quote: ... We injected worms with an injection mix containing Cas9 EnGen (NEB), 4 sgRNAs against mir-1 (AAGAAGTATGTAGAACGGGG ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 150ul of 10X NEB T4 DNA ligase buffer (NEB, B0202), 125ul of 10% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Immunology 2020Quote: ... 0.09% Tween-20) containing 0.2 mg/ml protease K (NEB, P8107S) and incubating at 56°C for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20µL of digestion mix containing 125U HinfI (New England BioLabs, #R0155M) and 25U RsaI (New England BioLabs ...
-
bioRxiv - Neuroscience 2021Quote: Samples containing Nluc-GPC4 were treated with Heparinase II (NEB P0735S) and Heparinase III (NEB P0737S ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5caC and 5fC containing oligonucleotides were synthesized by NEB (Ipswich, MA). dsDNA oligonucleotides were annealed in 10 mM Tris–HCl ...
-
bioRxiv - Cell Biology 2021Quote: Whole cell lysates or eluted proteins after affinity purification were treated with Protein Deglycosylation Mix II (NEB, Cat# P6044), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Deglycosylation of purified protein was performed in non-denaturing conditions according to manufacturer’s protocol (Protein Deglycosylation Mix II, NEB).
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biophysics 2019Quote: ... uncleaved fractions and 3C protease were removed by Ni-chelated sepharose and the G protein was dephosphorylated by lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: 750000 cells were harvested and resuspended in 40 μL lambda protein phosphatase reaction buffer (1X NEBuffer Pack for Protein MetalloPhosphatases (NEB), 1mM MnCl2 (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... was expressed as maltose-binding protein-tagged fusion protein using the pMAL(tm)c5X-vector (New England Biolabs, Ipswich, USA). The coding DNA sequence was amplified by PCR using gene-specific primers (for primer sequences ...
-
bioRxiv - Plant Biology 2021Quote: The MBP-NbERF-IX-33a fusion protein was prepared using the pMAL Protein Fusion and Purification System (New England Biolabs). E ...
-
bioRxiv - Plant Biology 2020Quote: ... and an aliquot containing 10 µg protein was treated with lambda protein phosphatase reaction mix following the instructions of the manufacturer (New England Biolabs) for 1 h at 30°C.
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Plant Biology 2024Quote: ... An aliquot containing 10 mg of protein was then subjected to lambda protein phosphatase reaction mix following the manufacturer’s instructions (New England Biolabs, US) for 1 hour at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: The PAQR-2p∷PAQR-1∷GFP construct was generated with a Gibson assembly cloning kit (NEB) with the following three fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Cap 1 25mer RNA was purified using Monarch RNA Cleanup kit (50 μg capacity, NEB). Complete methylation was verified by digestion of RNA with the Nucleoside Digestion Mix (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg of linearised DNA was then used in a HiScribe T7 synthesis kit (NEB), before DNase treatment and purification using a PureLink RNA mini kit (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... 1 µg of RNA was used for cDNA synthesis using the LunaScript RT SuperMix Kit (NEB) with and without reverse transcriptase (RT) ...
-
bioRxiv - Cell Biology 2020Quote: ... gel purified and ligated with pENTR (w158-1)-backbone by Quick Ligation kit (New England Biolabs) to create pENTR-GRET ...
-
bioRxiv - Cell Biology 2020Quote: β1-tubulin wild type construct was generated by the gibson assembly (HiFi Kit, New England Biolabs) of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT ...
-
bioRxiv - Genomics 2021Quote: ... ribosomal RNA depletion was performed using 1 μg RNA using NEBNext rRNA Depletion kit (NEB#6310). Concentration of final libraries was measured using Qubit 2.0 Fluorometer in combination with Qubit dsDNA HS Assay Kit (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg was used to generate dsRNA using a HiScribe T7 RNA synthesis kit (NEB). Reaction products were purified with the GeneJET RNA Purification Kit (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Cell Biology 2023Quote: ... Two micrograms of total RNA was circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 and used for the ligation using the Quick Ligation Kit (New England Biolabs). Specific base pair substitutions were introduced with site directed mutagenesis by polymerase chain reaction (PCR) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was reverse transcribed using LunaScript RT SuperMix Kit (New England Biolabs) according to the manufacturer’s instructions and 1 µl cDNA was used as a template for a 10 µl qPCR reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg of RNA was used for cDNA synthesis using the LunaScript RT SuperMix Kit (NEB) with and without reverse-transcriptase ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μL of magnetic beads protein A (NEB) were added to the mixture and incubated for 4 h at 4°C on a rotating wheel ...