Labshake search
Citations for New England Biolabs :
551 - 600 of 3107 citations for Mac 1 CD11b Rat Monoclonal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Torin at 1 µM (New England Biolabs), and Bafilomcyin at 10 nM (Sigma) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µL T4 DNA ligation buffer (NEB) 6.5 µL water ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µL of dNTPs (cat. #N0447, NEB), 0.5 µL of custom LNA-TSO [12 µM] (cat ...
-
bioRxiv - Biochemistry 2023Quote: ... and T4 RNA Ligase 1 (NEB, #M0204S), respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× Q5 reaction buffer (New England Biolabs), 200 µM dNTPs (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 1 (New England Biolabs #B7030) at 30°C for 1 hour followed by column purification ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 µl of Apyrase (M0398S, NEB), then incubated for 30 min at 30°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1 U/µL murine RNase inhibitor (NEB), 50 µM ATP and 1 x RNA ligation buffer (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... cut with 1 unit of BpiI (NEB) at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1 × Q5 polymerase reaction buffer (NEB) in a 20 μl reaction system ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1× Q5 polymerase reaction buffer (NEB) in a 20 μl reaction system.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 U/μL RNase inhibitor (NEB, M0314S), 1 mM NTPs (NEB ...
-
bioRxiv - Genetics 2024Quote: ... and 1× Q5 buffer (New England Biolabs). Thermal cycling was performed as follows ...
-
bioRxiv - Genomics 2023Quote: ... 1× Phi29 reaction buffer (New England Biolabs), and 15 units of Phi29 polymerase (New England Biolabs) ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mg/ml BSA (NEB cat #B9000S), 0.1% Tween20 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 U/μL Murine RNAse inhibitor (NEB), 400 nM 11S NanoLuc protein ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 1 mM BG-biotin or BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 μl of the purified axonemes in HMEEK buffer and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Genomics 2019Quote: ... approximately 1 ug of genomic DNA or WGA-DNA (See Suppl. Table 1) was dephosphorylated with Quick calf intestinal phosphatase (NEB) and CutSmart Buffer (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of previously assembled Cas9-RNP complex was added together with 1 μL of dATP (10 mM) and 1 μL of Taq polymerase (NEB) and incubated at 37ºC for 20 minutes and at 72ºC for five minutes for A-tailing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The L5 RNA linker at 1 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using by 1 U/ μl of RNA Ligase 1 (NEB) in the presence of 15% PEG8000 ...
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced into either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).