Labshake search
Citations for New England Biolabs :
551 - 600 of 7309 citations for 7 methyl 4 methylidene 1 propan 2 yl 2 3 4a 5 6 8a hexahydro 1H naphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Genomics 2022Quote: ... we use the methyl sensitive endonuclease ApeKI (NEB R0643L) in order to minimize the repetitive fraction sampled ...
-
bioRxiv - Genomics 2023Quote: ... 500 mM each of 50-methyl-dCTP (NEB N0356S), dATP ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Microbiology 2023Quote: ... or deglycosylated by an 1h treatment with PNGase F (NEB) then eluted in 2X Laemmli as previously described.
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs] ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μl of this lysate was directly used for PCR reactions with 2× Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... 3 U/µl T4 DNA polymerase (5 µl; New England Biolabs) and nuclease-free water (up to 100 µl) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... column-purified and transformed in 4 or 5 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Microbiology 2019Quote: ... 20 μg of total RNA were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) through a 16 h incubation at 16°C with 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Biophysics 2020Quote: For the insertion of an ATTO647N-labeled oligonucleotide complementary to the position 14711 bp from the biotinylated end of the λ DNA we employed the previously described strategy14 and followed the more recently described procedure.15 2 μg of λ DNA was incubated for 2 hours with the nicking enzyme Nt.BstNBI (20 units, NEB) at 50 °C in the nickase buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR product (2 μg) and pEYFP-C1 vector DNA (2 μg) were digested with BamHI-HF and HindIII-HF (New England Biolabs) according to the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The annealing was carried out in 96-well PCR plates by mixing 2 μL of each oligonucleotide at 100 μM with 2 μL of 10x T4 DNA Ligase Reaction Buffer (NEB) and 14 μL of water ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR reactions with plasmid and genomic DNA templates were performed using the Phusion High-Fidelity 2× Master Mix or Q5 High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...