Labshake search
Citations for New England Biolabs :
551 - 600 of 3385 citations for 5 TERT BUTYL 2 PROPOXY BENZENESULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... in 1x glycobuffer 2 (New England Biolabs), and 10% NP-40 (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μL T4 PNK (NEB, M0201L) were added to the sample in respective order ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3.13 μL BSA 2 mg/mL (NEB), 12.5 μL FastDigest NotI (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3.13 μL BSA 2 mg/mL (NEB), 12.5 μL FastDigest NotI (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10ng of 2-log ladder (NEB N3200L) was loaded instead of 100ng ...
-
bioRxiv - Genomics 2020Quote: ... in 1X Buffer 2 (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL of 10X NEB4 (NEB B7004S), 2.75 µL of Salmon Sperm DNA (250 ng ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 μL BSA (NEB, 20 mg/mL) and 400 units of DpnII (R0543M ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl T4 ligase (New England Biolabs), 2 μl SrfI (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 2 mM ribonucleoside-vanadyl complex (NEB) for 30 minutes at 30ºC before overnight incubation with 10nM probes in hybridization buffer (10% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... 25 µL 2× Q5 master mix (NEB); 1 µL 10 µM TruSeq PCR handle primer (IDT) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 μl fragmentase (New England Biolabs) and brought up to 20 μl in nuclease free water and incubated at 37°C for 20 minutes before stopping with 5 μl of 0.5M EDTA ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM ribonucleoside vanadyl complex (NEB S1402S), 100 units/mL SUPERase In (Thermo Fisher AM2694) ...
-
bioRxiv - Bioengineering 2020Quote: ... 2 U/µlL murine RNase inhibitor (NEB), 1.5 U/µl NextGen T7 RNA polymerase (Lucigen) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2% BSA (B9000S, New England Biolabs) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... 2 U of EcoRI (New England Biolabs) and one unit of T4 DNA Ligase in a total volume of 20 μL of 1X reaction buffer for one hour at 200 C ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 µl PNGase F (NEB P0704S), 3µl 10% NP40 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 0.1% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... 2 U/μl T4 DNA Ligase (NEB)
-
bioRxiv - Microbiology 2022Quote: ... 2 units of yeast Inorganic pyrophosphate (NEB) and T7 Polymerase for 4-6 hours ...
-
bioRxiv - Genetics 2019Quote: ... 2 U of Phusion DNA polymerase (NEB) and 0,2 mM dNTPs ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl T4 PNK (NEB, #M0201L)) at 37°C for 15 min ...
-
bioRxiv - Genomics 2020Quote: ... then 2 × 104 U of MNase (NEB) was added and incubated for a further 5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mg/ml BSA (New England Biolabs), 10 mM Tris-HCl pH 8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two concentrations of 2-log ladders (NEB) were included as reference for analysis ...
-
bioRxiv - Immunology 2021Quote: ... Step 2 was digested with EcoRI (NEB), blunted with Klenow (NEB ...
-
bioRxiv - Genetics 2019Quote: ... 2 μL of β-agarase (NEB M0392S) and 2 μL of RNAse A (Roche 1 119 915 ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 100 units/mL SUPERaseIn (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM vanadyl ribonucleoside complex (NEB, S1402S). The cells were then washed 4 times in wash buffer containing 25% formamide (Roche ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2 μM NLS-Cas9 (New England Biolabs) and 1x NLS-Cas9 reaction Buffer (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...