Labshake search
Citations for New England Biolabs :
551 - 600 of 7072 citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Biophysics 2022Quote: ... The gene sequences were flanked by restriction enzyme sites for 5’ NdeI and 3’ EcoRI (NEB). Genes were cloned into pET21a using standard protocols from NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μL of 1× PNK mix (2 μL of 10× PNK buffer (NEB), 2 μL ATP (SCP801 ...
-
bioRxiv - Genomics 2022Quote: ... 1 or 2 μl of 1U/μl USER® II enzyme (M5505S, NEB) and nuclease-free water to made up to 10 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM EGTA and 2 mM Vanadyl Ribonucleoside complex (VRC, New England Biolabs), washed three times with 70% ice-cold ethanol and kept at −20°C.
-
bioRxiv - Molecular Biology 2020Quote: ... PCR round 1 and 2 were performed using Q5-High Fidelity polymerase (NEB) for 6 (FS231 and FS232 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 ul RNaseOUT and 1ul T4 RNA ligase 2 truncated K227Q (NEB M0351). Samples were then washed twice with PNK buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2□ μl of 1× NEB Next Cell Lysis Buffer (New England Biolabs). FACS sorting was performed with a BD Influx sorter (BD Biosciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB, Set 1 #E7335S, Set 2 #E7500S). ChIP libraries were done following NEB’s guidelines (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Biochemistry 2023Quote: ... Oligo 1 and oligo 2 were annealed by T4 polynucleotide kinase (NEB, #M0201S) at 37 ℃ for 30 min and 95 ℃ for 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 μl were combined with 1 μl 10X T4 Ligation Buffer (NEB, M0202), 6.5 μl Nuclease-free H2O and 0.5 μl T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of 10x T4 RNA ligase 2 (truncated) buffer (New England Biolabs), 3 μl of 50% PEG 8,000 (New England Biolabs) ...
-
bioRxiv - Genetics 2023Quote: ... PCR-1 and PCR-2 amplicons were digested with DpnI (NEB Cat#R0176S) for 2 hours at 37°C to remove the YCp50-WT_PKR template ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of DNase I (2 U/μl, New England Biolabs) to 30 μl RNA product ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2′O-methylated using Vaccinia 2′O Methyltransferase (New England Biolabs). The IRES-containing mRNAs were uncapped and polyadenylated.
-
bioRxiv - Developmental Biology 2023Quote: Rehydrated embryos were blocked for 2 hs in 2% BSA (B9000, NEB) in PBS with 0.3% Triton X-100 (T9284 Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... gRNAs were annealed in (1 μl Forward primer, 1 μl Reverse primer, 5 μl Buffer 4 NEB, 43 μl H2O) by heating at 98 °C for 5 min and allowing the tubes to cool down to room temperature in the thermoblock (∼3h) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... 2 U M.CviPI (NEB), 160 μM S-adenosylmethionine (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM dNTPs (NEB), 0.5 µM forward and reverse primers (IDT) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2 μl DTT (NEB) and 2 μl of ProtoScript® II were added and the mixture incubated at 42°C for 12 hours with a 105°C heated lid ...
-
bioRxiv - Microbiology 2023Quote: ... in NEBuffer 2 (NEB) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM ATP (NEB) in a total volume of 25 μl ...
-
bioRxiv - Genomics 2023Quote: ... 1X NEBuffer 2 (NEB), 0.5 μM P5 primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation of the RNA 3’ Adapter (RA3) was achieved by using T4 RNA Ligase 1 (NEB, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligations were transformed into high efficiency (1-3 × 109 CFU/μg pUC19 DNA) competent cells (NEB C3040). The transformations were serially diluted and plated on LB with ampicillin (100 μg/ml) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL MgSO4 (4 mM; Biolabs, Ipswich, MA), 1.4 μL dNTPs (1.4 mM ...
-
bioRxiv - Systems Biology 2022Quote: ... 5’-AAAC(N)19-20-3’) by combining 1 μl of each 100 μM oligonucleotide with 1 μl of 10× T4 ligation buffer (NEB cat. no. B0202S), 6.5 μl of water ...
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...