Labshake search
Citations for New England Biolabs :
551 - 600 of 2474 citations for 4 METHANESULPHONYLBUTAN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Luna Universal One-Step RT-qPCR kit (E3005L) was used for qRT-PCR analysis following the protocol described by the supplier (NEB) by using a CFX96 real-time C1000 thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Immunology 2020Quote: ... the first one obtained by digesting the pcDNAI-GAL4-CREB vector with EcoRI and XbaI restriction enzymes (New England Biolabs), and the second part obtained by amplifying either the extracellular or the intracellular coding regions of the MerTK vector by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Microbiology 2022Quote: The copy number of viral RNAs were titrated by qRT-PCR using Luna Universal Probe One-Step RT-qPCR Kit (NEB) and LightCycler 96 instrument (Roche) ...
-
bioRxiv - Genomics 2022Quote: Real-time PCR (RT-PCR) amplification of RNA was performed following the Luna Universal One-Step RT-qPCR kit (New England Biolabs). A CFX 96 Touch Real-Time PCR Thermocycler/ Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Developmental Biology 2022Quote: ... at 4°C for up to one month until used for purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). Five larvae were pooled for each RNA purification and homogenized in DNA/RNA protection buffer with a glass homogenizer prior to proteinase K digestion ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining 50 μL was used as input for one round of end repair and adapter ligation with NEBNext Ultra II DNA Library Preparation kit (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... This plasmid was digested with XbaI and NheI enzymes to release TcZC3H12-HA sequence followed by the Neomycin expression cassette and treated with One Taq DNA polymerase (NEB) to allow for cloning in pCR2.1-TOPO plasmid (Invitrogen) ...
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Pathology 2021Quote: Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (NEB). Two gene targets were used for SARS-CoV-2 RNA detection ...
-
bioRxiv - Microbiology 2020Quote: ... separate reactions were performed for the quantification of SARS-CoV-2 N and E gene transcripts as well as cellular RNaseP for normalization using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) on a Bio-Rad CFX384 Touch system ...
-
bioRxiv - Microbiology 2021Quote: ... A 523bp fragment of ERV-DC7 or ERV-DC16 env genes was then amplified by PCR using One Taq DNA Polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... tropicalis pseudouridine synthase Pus7 was amplified from total RNA using the OneTaq One-step RT-PCR kit (New England Biolabs). XmaI and XhoI restriction sites were added with oligonucleotides and the resulting fragment was cloned into the p415Gal1 vector.
-
bioRxiv - Genomics 2020Quote: ... was incubated at room temperature for one hour with a mixture of 10 μl 5X Quick ligation buffer (New England BioLabs), 16μl nuclease-free water (Ambion) ...
-
bioRxiv - Biophysics 2020Quote: ... was functionalized at one end by annealing with a biotinylated oligonucleotide/5Phos/AGGTCGCCGCCCTTTTT/Bio (IDT) followed by ligation with T4 DNA ligase (NEB). The DNA was purified using a bead purification kit (Qiaex II ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Microbiology 2022Quote: ... from the original pSAG1-Cas9-GFP-UPRT (Shen et al., 2014)) for one targeting the LFM1 locus using the Q5 site-directed mutagenesis kit (NEB). 1 µg of the cassette and 1 µg of Cas9 plasmid were transfected into the LMF1-HA cell line using the Lonza nucleofection system ...
-
bioRxiv - Microbiology 2022Quote: ... To perform the qRT PCR we followed the recommendations of the manufacturer Luna Universal One-Step qRT-PCR Kit (New England BioLabs Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: Detection of viral genomes from heat-inactivated samples was performed by RT-qPCR using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 specific primers targeting the N gene region (5′-TAATCAGACAAGGAACTGATTA-3′ and 5′-CGAAGGTGTGACTTCCATG-3′ ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 500 ng DNase I treated total RNA or mRNA of one technical replicate was fragmentated to ~150 nt by magnesium RNA fragmentation buffer (New England Biolabs) for 4 min at 94°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteinase K was inactivated (20 min 82 °C) and the crRNA target site was amplified with One Taq Hot Start DNA polymerase kit (NEB), followed by Sanger sequencing (primers in Table S3) ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR for SARS-CoV-2 from cell lysates was performed using the TaqMan assay for the CDC N1 gene primers and probes from Integrated DNA Technologies (catalog no. 10006600; Integrated DNA Technologies) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) as previously described (6) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were then subjected to qRT-PCR of BB0838 and flaB transcripts using the Luna Universal One-Step RT-qPCR kit (NEB) and an ABI Prism 7500 system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... The corresponding bands were cut out and pooled all in one tube followed by purification using the Monarch DNA Gel extraction Kit (T1020; NEB) and subsequently repurified using the DNA cleanup kit (T1030 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed on 10 ng total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L). bin3 ...
-
bioRxiv - Microbiology 2023Quote: ... and oligonucleotides crp500F and crp500R (one of which was labeled with [γ32P]ATP by use of T4 polynucleotide kinase (NEB)) ...
-
bioRxiv - Plant Biology 2023Quote: ... The reactions were completed in a final volume of 10 µl using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs), and relative gene expression analysis using the Livak method was per-formed 53 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Bioengineering 2023Quote: RT-qPCR was carried out from the isolated RNA using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The Ct values of samples were determined by quantitative PCR (qPCR) using a Luna Universal Probe One-Step RT-qPCR Kit (cat. #E3006, New England Biolabs) with LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral RNA quantification was performed by RT-qPCR using the IP4 set of primers and probe and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Dual-indexing was carried out with the TruSeq panel of indexing primers in a short-cycle PCR using Luna Universal Probe One-Step RT-qPCR reagents (NEB). The pooled adapter libraries were purified and size-selected using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and quantitative real-time PCR was performed using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 96-well plate and qPCR was performed in a LightCycler 96 System (Roche) ...
-
bioRxiv - Systems Biology 2023Quote: ... RT-qPCR quantification was carried out on 20 ng of RNA with the Luna One-Step RT-qPCR Kit (NEB). All qPCRs were performed in technical triplicates ...
-
bioRxiv - Cell Biology 2023Quote: ... a sequence encoding mCherry was added on one side of the tet-inducible bi-directional promoter by conventional restriction cloning (BamHI & SpeI; New England Biolabs). The coding region of a human F-box domain (215 amino acids [aa] ...