Labshake search
Citations for New England Biolabs :
551 - 600 of 654 citations for 4 4' Bi 7H benz de anthracene 7 7' dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysates were incubated for 1 hour at 4 °C on a nutator with 40 µL amylose resin slurry (New England Biolabs) equilibrated with amylose wash buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Biochemistry 2024Quote: ... Synthesized cDNA was then diluted 4-fold and 1 μL was used as template for real-time qPCR using Luna Master Mix (NEB). Values were normalized to GAPDH ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The target genomic locus was amplified with the primers listed in Supplementary Table 4 using the Q5 Hot Start High-Fidelity Polymerase (NEB). Editing frequencies were assessed by T7E1 assay or targeted amplicon sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... The reaction mixtures were incubated for 1 h at room temperature and mixed with 4 μL of 6X gel loading dye (New England Biolabs). Following electrophoresis in 1.2% agarose gel containing SYBR safe DNA gel stain (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... The beads were washed three times with PNK wash buffer and the RNA-protein complexes labeled with 32P with the following reaction: 4 μl 10X PNK buffer (NEB), 2 μl T4 PNK enzyme ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...
-
bioRxiv - Biochemistry 2024Quote: ... Ig3-4 was purified using the same method as Ig3/Ig4 with the addition of an amylose column (New England Biolabs) chromatography step to remove the MBP tag prior to cation exchange ...
-
bioRxiv - Genomics 2024Quote: ... samples between 4 and 24 mol/µl were amplified by selective whole genome amplification (sWGA) using the enzyme phi29 DNA Polymerase (NEB) before the genotyping ...
-
bioRxiv - Genomics 2024Quote: The efficacy of the methylation protocol was verified by methylation of a control library (CL) (Table 4) followed by enzymatic digestion using BstBI (NEB). 1 μg of both modified and unmodified CLs were mixed with 1 μl enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... was incubated in a reaction volume of 50 µl at 37°C for 18 h with 10 U of T4 beta-glucosyltransferase (T4-BGT) in the presence of 80 µM UDP-glucose in NEBuffer 4 (all New England Biolabs). Control reactions were incubated without T4 beta-glucosyltransferase ...
-
bioRxiv - Biochemistry 2024Quote: ... and the amount of AP activity in the supernatant and lysates was measured at an absorbance of 405 nm over a 90-minute time course following the addition of 1 mg/mL 4-nitrophenyl phosphate (New England Biolabs), using a BioTek SynergyH1 microplate reader ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted protein was detected via Bradford assay and immediately applied to a 1 mL amylose column at 4°C (New England Biolabs) at 10-15 ml/hr that was pre-equilibrated with nickel elution buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted at 7200rpm for 2min at 4℃ and washed once with cold 1.4× NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4× NEB buffer 3.1 containing 0.1% SDS and incubated at 65℃ for 10min ...
-
bioRxiv - Molecular Biology 2020Quote: ... EcoRV de-staining buffer (deionized water containing 1X cut-smart buffer and 200 units of EcoRV (NEB, #R3195S) in 500ul) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNase I de-staining buffer (PBS containing 1X DNase buffer and 20 units of DNase I (NEB, #M0303) in 500ul) ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... The duplex was then ligated with lentiCRISPRv2 precut by Bsm BI (New England Biolabs) using T4 DNA ligase (Takara Bio) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 mL of culture was removed and treated with DNase I (New England Biolabs; 4 µL and 25µL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... another 1 million cells were processed in only DigWash and during Dam activation incubated with 4 units of Dam enzyme (NEB, M0222L). This Dam control sample serves to account for DNA accessibility and amplification biases.
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The left lung lobe was used for histological analysis of tumor development (hematoxylin and eosin) after fixation in 4% formaldehyde (Biolabs, Israel). Right lung lobes were minced and digested with 5 mL digestion buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 mM Tris-Cl pH 7.4, 12 mM MgCl2, 1% NP-40, 0.5 mM DTT, 0.1 mg/ml cycloheximide, 80 U/ml NEB murine RNase inhibitor). Beads were transferred to a fresh tube and immunoprecipitated RNA extracted by incubating beads in buffer RLT (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...
-
bioRxiv - Synthetic Biology 2022Quote: All pLS plasmids listed in Supplementary Table 4 were synthesized as gBlocks by IDT and circularized either by ligation with T4 DNA ligase (New England Biolabs, USA), or ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.