Labshake search
Citations for New England Biolabs :
501 - 550 of 9031 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and +1 sites of the promoters controlling transcription of both RNAs were used to amplify the standard pUC19 plasmid (NEB). After PCR amplification samples were digested with DpnI (NEB ...
-
bioRxiv - Immunology 2021Quote: ... The template for in vitro transcription was a PCR amplicon from the pLMCT-RBD-6His produced using the PHUSION high fidelity DNA polymerase (NEB) and TGTGGAATTGTGAGCGGATA as forward primer and CTTCACTATTGTCGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA as reverse primer.
-
bioRxiv - Molecular Biology 2020Quote: ... and the CMV promoter was removed to prevent aberrant transcription by digesting the plasmid with ClaI-HF and BamHI-HF (NEB), gel extracting ...
-
bioRxiv - Synthetic Biology 2019Quote: Immobilized toeholds strands bound on the magnetic beads were mixed with 30 µL of in vitro transcription buffer (NEB, E2050) containing 2 µL of T7 RNA Polymerase Mix and ATP ...
-
bioRxiv - Biochemistry 2019Quote: ... complexes were eluted for 30 min at 25° with rotation in 40 μl of the Transcription Buffer with 60 units of either SspI-HF or PstI-HF (New England Biolabs) as indicated (see Fig ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed for 5 hours at 42 °C using 100 U of ProtoScript® II Reverse Transcriptase (NEB), 10 U of RNase Inhibitor (Murine ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Biochemistry 2020Quote: DNA templates for in vitro transcription were amplified by PCR using custom DNA primers (IDT) and Phusion Hot Start polymerase (New England BioLabs). 2.5 mL transcription reactions were assembled using a 1000 μL PCR reaction ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: ... Transcription reactions were set up with RNA NTPs (5 mM each ATP, CTP, UTP, 9 mM GTP) (NEB, Ipswitch, MA), 0.004 U/µL Thermostable Inorganic Pyrophosphatase (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... the 560 bp region upstream of the transcription start site was amplified using Q5 high fidelity DNA polymerase (NEB, England) and ligated into EcoRV digested SK+ cloning vector ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (M0253, NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with genespecific primers using SsoAdvanced Universal Sybr green Supermix (1725271 ...
-
bioRxiv - Microbiology 2021Quote: ... Five hundred nanograms of linearized pBSKS-dhfr vector was used as a DNA template for in vitro transcription with T7 RNA Polymerase (New England Biolabs) at 37 °C for 4 h in a 20 μl reaction mixture ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 nM Ca2+ and 10 μM purified Calmodulin (CaM) in the coupled transcription/translation PURE system (New England Biolabs, USA), which contains a defined set of purified translation factors and E ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 μl reverse transcription reactions or ∼10 ng genomic DNA were then subjected to PCR amplification by the high-fidelity Phusion polymerase (NEB) in 50 μl reactions using the primer pairs listed in Supplementary Table S1 and the following cycling program ...
-
bioRxiv - Genetics 2022Quote: A DNA template for in vitro transcription was generated by PCR using oligos TE122 and TE126 on plasmid pCT-TE2 and Phusion DNA polymerase (NEB) in HF buffer (Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: ... coding sequences and terminators were assembled together into the transcription unit acceptor plasmid (POT1-ccdB) by Golden Gate assembly using Esp3I (NEB); these are low-copy centromeric plasmids with URA3 selection marker ...
-
bioRxiv - Microbiology 2021Quote: In vitro RNA capping was achieved using RNAs produced by in vitro transcription as substrate and the Vaccinia capping system (NEB). The 37-mer (50 μM ...
-
bioRxiv - Bioengineering 2019Quote: ... with 3, 6, or 12 nM iSpinach DNA (IDT, USA, Ultramers) template in transcription buffer (1x RNAPol Reaction Buffer (NEB, No ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (M0253, NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with gene-specific primers using SsoAdvanced Universal Sybr green Supermix (1725271 ...
-
bioRxiv - Developmental Biology 2020Quote: ... To make the sgRNA we linearized purified pDR274 containing the guide sequence with Dra1 and used a T7 RNA polymerase for in vitro transcription (NEB). The pMLM3613 plasmid encoding cas9 was used for in vitro transcription using the SP6 mMessage mMachine Kit (Ambion ...
-
bioRxiv - Molecular Biology 2019Quote: ... The purified DNA was used to generate the corresponding RNA by in vitro transcription using HiScribe T7 polymerase (NEB #E2040S). After purifying the RNA with carboxylate-modified magnetic beads ...
-
bioRxiv - Molecular Biology 2020Quote: Linear DNA templates for in vitro transcription were generated from pNB1u or pOO2-GW plasmid by PCR using Phusion High-Fidelity DNA Polymerase (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: DNA templates for in vitro transcription were amplified by PCR using custom DNA primers (IDT) and Phusion Hot Start polymerase (New England BioLabs). 2.5 mL transcription reactions were assembled using 1000 µL PCR reactions as template (∼0.2 µM template DNA) ...
-
bioRxiv - Developmental Biology 2021Quote: ssRNA was transcribed directly from the PCR amplicon product in a reverse transcription reaction using a HiScribe T7 polymerase (NEB). The DNA template was then removed through treatment with DNase1 ...
-
bioRxiv - Microbiology 2021Quote: The DNA template for T7 transcription was prepared by linearizing the T7 replicon plasmid (#453, Supplemental Table I) with the restriction enzyme SacII (NEB), followed by protease K treatment ...
-
bioRxiv - Immunology 2020Quote: ... The linearized plasmids were purified and utilized as templates in a T7 ARCA in vitro transcription reaction (New England Biolabs). The mRNA product was then purified using an Invitrogen Purelink RNA mini kit according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... after reverse transcription of pulled-down RNA and synthesis of a second strand (NEBNext mRNA second strand synthesis module (NEB)) ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 μg of total RNA was used for cDNA synthesis by reverse transcription reaction with Protoscript II reverse transcriptase (New England Biolabs). Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE) ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The yrbA-fs15 DNA templates (with TAG or TGA stop codons) used for in vitro transcription/translation reactions in the classic PURExpress system (New England Biolabs) were prepared by PCR ...
-
bioRxiv - Microbiology 2023Quote: ... was used as a template for in vitro transcription using Hi-T7 RNA Polymerase and Ribonucleotide Solution Mix (both from New England Biolabs) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA of NmeCas9 was synthesized by in vitro transcription with T7 RNA polymerase and plasmid DNA templates linearized by HindIII-HF (New England Biolabs). The sgRNA sequence was listed in Supplementary Table S1 ...
-
bioRxiv - Biochemistry 2022Quote: Drosocin-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Genetics 2023Quote: ... we first amplified the 4,165 bp region upstream of the transcription start site of the betta actb gene using Q5 polymerase (M0491S, New England Biolabs) from an ornamental betta ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A plasmid harboring Cas9 and an empty guide RNA transcription cassette was linearized by NotI/BsaI double digestion (New England Biolabs) and transformed into yeast together with a linear piece of DNA containing the guide RNA sequence flanked on either side by homology to the plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were combined into a transcription unit plasmid in a Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs). The destination vector (p15A origin of replication ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA template used for in vitro transcription was generated by PCR amplification from the corresponding reporter plasmid using the Q5 High-Fidelity DNA Polymerase (NEB) with a reaction including a forward primer containing the T7 promoter sequence and a 60T reverse primer for polyadenylation ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... coli constitutive ribosomal promoter J23119 with a poly-T region directly downstream of the sgRNA sequence for transcription termination using KLD mutagenesis (New England Biolabs). pBR322 and pET28 expression plasmids were co-transformed into E ...
-
bioRxiv - Cancer Biology 2024Quote: ... Double-stranded cDNA was then synthesized by reverse transcription and underwent end-repair and ligation using New England Biolabs (NEB) adapters ...
-
bioRxiv - Biochemistry 2024Quote: ... The HDV sequence was cloned into the XbaI/EcoRV sites of the AVA421 vector to enable linearization for run-off transcription by digestion with EcoRV-HF (NEB) in a reaction containing 1X CutSmart buffer and 0.4 U/μl EcoRV-HF.
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...