Labshake search
Citations for New England Biolabs :
501 - 550 of 973 citations for Hepatitis C Virus Core Antigen HCcAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... A 20 min A-tailing step (72 °C, 0.2 mM dATP) was performed with taq polymerase (NEB, Ipswich, USA).
-
bioRxiv - Microbiology 2022Quote: ... This was then incubated at 37 °C for 1.5 h with 50 μL of 10× CutSmart Buffer (New England BioLabs) supplemented with 5 mM CaCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 404–561 with a C terminal His tag added was cloned into the pMAL-c5x vector (New England Biolabs), and were transformed in E ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of genomic DNA was digested with the restriction enzyme AatII overnight at 37°C to generate fragments of genomic DNA which were on average 1,500 bp (New England Biolabs). The digestion product was then treated with Antarctic phosphatase for 1 hour at 37°C (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... pCHYC-1 and a 500 bp ‘hfaE C-terminal PCR product were digested with HindIII-HF and KpnI (NEB) and ligated with T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were incubated at 37°C for 1 h after the addition of T4 PNK (New England Biolabs M0201) to allow 5’-hydroxyl repair ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid transformation was achieved by using the heat shock method (42°C, 47s) in DH5α competent cells (NEB, C2987H), then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were then incubated at 42°C overnight with the addition of 3 μl of β-agarase (NEB). The DNA mix was then gently poured into combing reservoirs containing 1.2 ml MES and the genomic DNA was combed onto salinized coverslips (Genomic Vision ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl of a mix preheated to 37°C and containing 2.5 U of RNase H (New England Biolabs), 2.5× RNase H reaction buffer (1× buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10-15 ng of each PCR product were digested at 37 °C for 60 min with 2.5 units of XcmI (New England Biolabs) in 15 μl reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the parts were assembled with Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix from NEB, 1h at 50°C) with the linkers providing sequence overlaps ...
-
bioRxiv - Biochemistry 2023Quote: ... In a 50 μL reaction 1 μg of backbone plasmid (starting_eGPARK2iM) was digested at 37 °C for 1 hour with MluI-HF and EcoRI-HF (New England Biolabs), then heat-inactivated at 65 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 μl of 0.1∼1 μg genomic DNA was mixed with 10 μl of 2X C-circle master mix [0.2 mg/ml BSA (NEB), 0.2% Tween-20 ...
-
bioRxiv - Biophysics 2023Quote: ... We digested the cosmid-i95 for 2 h at 37°C using SpeI-HF restriction enzyme (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2023Quote: For DNA-RNA hybrid IP (DRIP) non-crosslinked lysates were incubated (1 h, 37°C) with 10U RNaseH (NEB) prior to immunoselection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 37°C with rotation) in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The extracted chromatin was digested for 3 hours at 37 °C in a volume of 250.0 μL with 100 U of NlaIII (NEB) for 3C library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... An aliquot of 10 μg DNA was digested overnight at 37°C using NlaIII and MseI restriction enzymes (NEB), purified using Sera Mag Speedbeads (Thermo Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... The C-terminal Flag tag was introduced into pcDNA3.1-Spike-WT thanks to NEBuilder® HiFi DNA Assembly (NEB). The Flag tag was added during amplification of Spike-WT from pcDNA3.1-Spike-WT with the primers ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was inactivated at 25 °C for 10 min with 1.25 μL of Murine RNAse inhibitor (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 mM EDTA) and digested with DraIII-HF in 1x CutSmart buffer for ∼20 hr at 37 °C (NEB). Fragments with DraIII sticky ends were re-purified by 1 mL mono-Q ion-exchange ...
-
bioRxiv - Cell Biology 2023Quote: ... APOE3-C-mEm ΔSS were created from APOE3-mEm using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). The N-terminal domain constructs consist of residues 19-209 with or without residues 1-18 of the N-terminal signal peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... were then denatured at 95°C for 5 min and cooled at room temperature to form heteroduplexes using NEBuffer2.1 1x (NEB). The T7 endonuclease I (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The libraries were generated by blunt-end cloning of 1,200 ng fragmented DNA into 1,000 ng PmeI linearized and dephosphorylated pHORF3 library vector (a gift from Michael Hust, Technische Universität Braunschweig) (16 hr at 16 °C, T4 DNA Ligase, NEB). The ligation reaction was purified and transformed into TG1 bacteria (Lucigen ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Genomics 2023Quote: Hi-C single-index library preparation of MCF7 cells was performed as previously described using MboI (New England Biolabs) restriction enzyme (30).
-
bioRxiv - Cell Biology 2023Quote: ... The ligation (400 μl) was performed overnight at 16°C in 1x T4 Ligase buffer (New England Biolabs (NEB)) supplemented with 5 mM Mg(OAc)2 ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The ligation (400 μl) was performed overnight at 16°C in 1x T4 Ligase buffer (New England Biolabs (NEB)) supplemented with 5 mM Mg(OAc)2 ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
bioRxiv - Developmental Biology 2024Quote: A Primer Exchange Reaction concatemerization reaction (1X PBS; 10 mM MgSO4; dNTP, 0.6 mM of A, C, and T, NEB-N0446S ...
-
bioRxiv - Genomics 2024Quote: ... The ligation of vectors with gRNA inserts was performed overnight at 4°C using T4 DNA ligase (NEB, M0202). The ligation products were then transformed ...
-
bioRxiv - Cell Biology 2023Quote: ... and TurboID from Dr. Alice Ting’s plasmid (Tess C. Branon et al., 2018) via PCR using Q5 high-fidelity (M0492, NEB). Next ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 s annealing at 63 °C and 30 s elongation by Q5 High-Fidelity DNA Polymerase (New England Biolabs) at 72 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 25 °C) using a custom methionine(-) Flexible In vitro Translation system composed by PURExpressTM (ΔRF123) Kit (New England Biolabs) solution B ...
-
bioRxiv - Biochemistry 2024Quote: ... Cleavage reactions were incubated at 37°C for 1 hour and subsequently worked up with 0.2 mg/mL RNase A (New England Biolabs) and 4 units of Proteinase K (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... C-terminal Cx36 mutants were generated using the Q5 site directed mutagenesis kit (E0554S; New England Biolabs, Ipswitch, MA) and corresponding primer pairs introducing gaps into the Cx36 coding sequence ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of RNA for each sample was treated with DNase I at 37°C for 10 minutes (New England Biolabs) and 0.5 µg was used for reverse transcription with the GoScript Reverse Transcription Mix ...
-
bioRxiv - Biophysics 2021Quote: ... The AcrIIA4 expression vector was modified to express AcrIIA11 with a C-terminal NLS and HA tags using the HiFi Assembly Kit (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... RNA integrity was assessed by performing 1% TBE agarose gel electrophoresis with samples that had been boiled for 95°C for 5 min in RNA loading dye (New England Biolabs). Genomic DNA was eliminated by incubating 2 μg of RNA with 2 U of RQ1 RNase-free DNase I (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-3xFLAG (C-terminal tag) using T4 DNA ligase (New England Biolabs). pcDNA4/TO-ORF24 202-752-3xFLAG (Addgene #138424 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell debris was removed by centrifugation at 15,000 x g for 30 min at 4°C and the clarified extract was loaded onto a chitin resin (NEB) column pre-equilibrated with column buffer for purification at RT ...
-
bioRxiv - Genetics 2021Quote: ... which was followed by 37°C for 30 min with addition of 50ul 10% Triton-X 100 to quench SDS and 37°C overnight with addition of 40ul AluI (R0137L, NEB) total ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were individually treated for 16 h at 37 °C with 20 units of DpnI enzyme (New England Biolabs). Following gel extraction using Wizard SV Gel and PCR CleanUp System (Promega) ...