Labshake search
Citations for New England Biolabs :
501 - 550 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 1 μl Cutsmart buffer and 1 U Sau96I (New England Biolabs) were added into the system ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of SUPERase_In and 1 μl of T4 PNK (NEB)) and incubated at 37 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 unit/µl T4 RNA ligase 1 (New England Biolabs, M0204S) and incubated at 23°C for 150 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were mixed 1:1 with 2x RNA dye (NEB B0363S), loaded on TBE gels ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of 1 unit mL-1 SfoI restriction enzyme (NEB) was injected to generate blunt-end DNA molecules.
-
A universal fluorescence-based toolkit for real-time quantification of DNA and RNA nuclease activitybioRxiv - Biochemistry 2019Quote: ... Klenow Fragment (3’ → 5’ exo-; New England Biolabs), RNase A (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... Diatom exconjugants were selected on 1/2L1 1% agar medium supplemented with 20 μg mL−1 phleomycin (Gold Biolabs) at a diel cycle of 14:10 at ~50 μE ms−1 light intensity.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg non-methylated NEAT1_1 IVT product was radio-labelled with radioactive labelling mix (1 µL 10x PNK buffer, NEB, 1 µL NEAT1_1 IVT product, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this was then combined with 5 μL Q5 buffer (NEB, cat#M0491 S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN, N is for a random nucleotide) by T4 ligase 1(NEB) sequentially ...
-
bioRxiv - Genomics 2020Quote: ... each eluted insert was mixed with 50ng pDXinit-PAC in a molar ratio of 1:5 (vector:insert) in 10μl reactions and digested with 0.5μl SapI (NEB) for 1h at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 40 nM down primer and 5 μM dNTP in 17 μl 1 x CutSmart buffer (NEB). The RNA and primers were incubated at a temperature gradient ...
-
bioRxiv - Molecular Biology 2023Quote: ... These were eluted and precipitated before ligation to 5’ adapters (1× T4 RNA ligase buffer (NEB), 0.5 µM p10IllLigup adapter ...
-
bioRxiv - Plant Biology 2022Quote: ... We then ligated single-stranded rP5_RND adapters to 5’-ends with T4 RNA ligase 1 (NEB). Ligated RNAs were enriched and captured by oligo(dT ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs, 5 U μg-1 of protein) were added with gentle mixing after each addition ...
-
bioRxiv - Microbiology 2024Quote: ... 5 units (2.5 μL) of RNase free DNAse I (NEW ENGLAND BioLabs, 2000 u. mL-1) and 100 μL of nuclease free water was added for every 10 μg of RNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Pathology 2020Quote: ... at 65⁰C for 2h followed by MspI (NEB R0106) at 37⁰C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of 10x RE buffer 4 (NEB), 2 μL of exonuclease T7 (10,000 units/mL ...
-
bioRxiv - Microbiology 2019Quote: ... 4 μl of Low Range ssRNA ladder (NEB) or 5 μl RNA molecular weight marker I DIG-labelled (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 U of alkaline phosphatase from Biolabs (# M0290) and 5 mU of phosphodiesterase I from Sigma (# P3243-1VL ...
-
bioRxiv - Genetics 2020Quote: ... 4 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Genomics 2020Quote: ... [4 µl 5x NEB FirstStrand buffer (NEB; E7421AA), 0.25 µl SUPERase-In ...
-
bioRxiv - Neuroscience 2021Quote: ... and the 4 base restriction enzyme Mse1 (NEB) under standard double digest conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 μl of Calf intestinal alkaline phosphatase (NEB) was added to dephosphorylate the RNA for 15 min at 37 °C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 50% PEG-800 (New England Biolabs), 4 μl 10× T4 RNA ligase buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 total U of Proteinase K (NEB) at room temp for 10 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and 4 units of Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Genomics 2019Quote: ... 4 μl of T4 DNA ligase (NEB, M0202L) were added and the tubes were incubated at room temperature for 4 hours with slow rotation ...
-
bioRxiv - Genetics 2021Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...