Labshake search
Citations for New England Biolabs :
5301 - 5350 of 6023 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... cells were digested for 2 hours at 37°C using 375U of MboI (NEB, Cat. #R0147). After biotin filling ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ligation was performed in 25% PEG 8000 (61) by T4 RNA Ligase 2 Truncated K227Q (NEB) for 8 h at 16°C ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Genomics 2024Quote: ... 2.) Size fractionation was performed using the NEBNext Ultra II FS DNA module (New England Biolabs), 3. ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... an aliquot of approximately 10 μg of RNA was treated with 2 units of DNase (NEB) in a final volume of 100 μL for 10 min at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... the pMIR319C containing pMW#2 reporter constructs were linearized with XhoI (R0146, New England Biolabs, USA) and integrated into the mutant HIS3 locus of the YM4271 host strain (Gift from Ram Yadav ...
-
bioRxiv - Microbiology 2023Quote: ... mmpL10 and papA3 and the flanking intergenic sequence was amplified using Q5 HiFi 2× MasterMix (NEB) from genomic DNA isolated from M ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Genetics 2022Quote: ... 25 µl LongAmp Hot Start Taq 2’ Master Mix (New England BioLabs, Frankfurt am Main, Germany). The PCR program was 94°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were placed on ice for 2 minutes before adding 250 µL SOC medium (Biolabs #B9020S). The transformed cells in medium were incubated in a shaker for 1 hour at 37°C and 225 RPM ...
-
bioRxiv - Systems Biology 2023Quote: ... 400 µL of RNAlater and 2 µL of 20 mg/mL BSA (New England Biolabs # B9000S) were added to the samples and incubated on ice for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Cancer Biology 2023Quote: ... and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB). After 5’ deadenlyase and RecJ exonuclase treatment ...
-
bioRxiv - Bioengineering 2023Quote: ... 40 U/mL Rnasin) and then resuspended in ligation buffer plus 2 μM SplintR Ligase (NEB). Cells were incubated for 1h at 37 ºC with gentle agitation.
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Riboswitch samples were prepared by splinted ligation using T4 RNA ligase 2 (New England Biolabs M0239S). 5 nanomoles each of the 5’ and 3’ segments of the riboswitch and the DNA splint were combined and heated to 90 °C for 2 minutes and then allowed to cool to RT over 10 minutes ...
-
bioRxiv - Genetics 2024Quote: ... and libraries were generated by PCR with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541). Prior to sequencing ...
-
bioRxiv - Immunology 2024Quote: ... The region of interest was then amplified using Q5 2× mastermix (New England Biolabs, cat. M0492S), 500 ng of template DNA ...
-
bioRxiv - Genomics 2024Quote: A ligation reaction was then assembled by combining 2 μl 10x T4 DNA ligase buffer (NEB), 1 μl annealed 20 μM Index_A_XX stock ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated for 2 hours at 30 ° C and stopped by addition of 0.2 U apyrase (NEB), incubated at 30 ° C for 20 mins ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pLenti CRISPR V2 was digested for 2 h at 50°C with Bsmb1 (NEB, R0580S) and the resulting digested fragment was purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel ...
-
bioRxiv - Systems Biology 2024Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added at 25°C for 1h ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was subjected to end-repair in the same reaction by adding 1 μl of Klenow fragment (New England Biolabs cat. M0210S, 5000 U/ml) and 1 μl of dNTP mix (10 mM dA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT, NEB #M0368L for ProtoScript II RT, and NEB #M0253L for M-MuLV RT). After 20 minutes of incubation at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Epidemiology 2019Quote: ... The MethylRAD library was prepared by digesting 200 ng genomic DNA for each sample using 4 U of the enzyme FspEI (NEB, USA) at 37 °C for 4 h ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The left lung lobe was used for histological analysis of tumor development (hematoxylin and eosin) after fixation in 4% formaldehyde (Biolabs, Israel). Right lung lobes were minced and digested with 5 mL digestion buffer ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...