Labshake search
Citations for New England Biolabs :
5001 - 5050 of 9843 citations for Swine IL 4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids with various mutations were generated by PCR methods using Q5® Site-Directed Mutagenesis Kit (NEB) according to the instructions and verified by Sangon ...
-
bioRxiv - Biochemistry 2024Quote: ... The transcription process was driven by T7 polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB). After 2h transcription ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L). Target sequences were amplified using a modified touchdown PCR protocol (Korbie and Mattick ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Sequencing libraries were generated using NEB Next® UltraTM DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA isolated from cells was reverse transcribed using LunaScript® RT SuperMix Kit (New England Biolabs) to generate cDNA as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from overnight cultures using the Monarch Genomic DNA Purification Kit (New England Biolabs) and quantified using the Qubit Broad Range dsDNA kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Second strand synthesis of the cDNA was carried out using the NEBNext second strand synthesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: TT-seq libraries were built using the NEBNext Ultra II RNA Library prep kit for Illumina (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Mutagenesis of RBK21 constructs was carried out using the Q5 Site Directed Mutagenesis kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The in vitro transcription assay was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from the agarose gel fragments using a gel extraction kit (New England Biolabs, T1020L) following manufacturer instructions with modification ...
-
bioRxiv - Immunology 2024Quote: ... Fragmented DNA was purified using the NEB Monarch PCR&DNA Cleanup Kit (cat. T1030S, New England Biolabs). DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quantification was done using NEB Next® Library Quant Kit for Illumina® (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... inserted in plasmid vector pUC19 with the Gibson Assembly Master Mix kit (New England BioLabs, NEB # E2611S). Mutagenesis was carried out with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from samples using the Monarch® Total RNA Miniprep Kit (New England Biolabs, T2010S) and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was synthesized from 300 ng of purified RNA using LunaScript RT SuperMix kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... RNAseq libraries were constructed using a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). mRNA pull-down was performed using the Magnetic Isolation Module (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... POINT-seq libraries were made with the NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB). POINT5-seq libraries were made with the SMARTer Stranded RNA-Seq kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and in vitro transcribed RNA was purified using the using the Monarch® RNA Cleanup Kit (NEB). Full-length 5’ RACE was performed using the GeneRacer™ with Superscript™ III RT kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... coli isolates was purified using a Monarch DNA purification kit (New England Biolabs Japan Inc., Tokyo, Japan). DNA concentrations were measured using Qubit™ 4 fluorometer with Qubit™ 1× dsDNA High Sensitivity (HS ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing libraries were generated using a NEBNext®UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitated chromatin was used for NGS library preparation (NEBNext Ultra II DNA Library Prep Kit for Illumina, NEB). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA of all cell lines was isolated using Monarch Total RNA miniprep kits (#T2010S, New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... NGS libraries were prepared using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: Poly-A RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2020Quote: ... Prokaryotic DNA was enriched from the total hindgut DNA extract using NEBNext Microbiome DNA Enrichment Kit (NewEngland BioLabs). Following sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA (XXXXXXXX for KPC1 or CGGCGGCGGGATGTTCGTGC for KPC2) were synthetized in vitro using EnGen sgRNA Synthesis kit (NEB) and purified using RNA clean and concentrator (Zymo Research) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sequencing libraries were constructed with NEB NextR UltraTM DNA Library Prep Kit for Illumina (NEB, United States) following the manufacturer’s instructions and index codes were added ...
-
bioRxiv - Cell Biology 2020Quote: ... The FER1 Ca2+-binding mutants in the C2D domain were generated by Q5 site directed mutagenesis kit (NEB) using primers 4833/4834 to change positions A1622 and A1634 to C resulting in Asp codon 542 and 545 changes to Ala.
-
bioRxiv - Cell Biology 2020Quote: ... Single or double mutations were produced with the Q5® Site-directed Mutagenesis kit (New England Biolabs, UK) using the primers in Table 1.
-
bioRxiv - Cell Biology 2020Quote: ... and pFLOE1p:FLOE1ΔDUF-GFP were obtained by modifying pFLOE1p:FLOE1-GFP using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with primers priDSdeletion-FWD/REV ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645), with adapters diluted 1:5 from the supplied concentration ...
-
bioRxiv - Genetics 2021Quote: ... and stranded RNA-seq libraries were prepared using random hexamer and NEB directional RNA library prep kit (NEB) and sequenced on the NovaSeq 6000 PE150.
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Genetics 2021Quote: ... libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs), using the appropriate protocols for DNA samples of 50 ng (lower input ...
-
bioRxiv - Developmental Biology 2021Quote: ... SWS point mutation of G to A was generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with primers 5’-CATCCAGCGCaGGGTGACAAG-3’ and 5’-TCCTGGAAGGTGGTGGCA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... and subjected to Tru-seq library construction using NEBNext Ultra II DNA Library Prep kit (NEB, Cat E7645S) as standard protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit (NEB, Cat E7645S). DNA was end-repaired ...
-
bioRxiv - Molecular Biology 2021Quote: ... The T718A substitution was created in pYES2-TOP1 using the Q5 site-directed mutagenesis kit (New England BioLabs) with primers 5’-TCGCCTGGGAGCCTCCAAACTCA-3’ and 5’- ATCTGTTTATTTTCCTCTCGGTCTGTG-3’.
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs Inc., Ipswich, MA, USA). Manufacturers’ instructions were followed for end repair ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing libraries were made using the NebNext UltraII DNA kit for Illumina (New England Biolabs, Ipswich, Mass., USA), and PE150 sequencing conducted by Novogene (Beijing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products from all reactions were pooled and purified with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Peptide constructs were assembled and integrated upstream of Venus using the NEBuilder HiFi Assembly kit (New England Biolabs). Correct assembly was verified by sequencing of inserts and flanking regions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Products from the first round PCR were then purified using Monarch DNA Gel Extraction Kit (New England Biolabs) and used as the templates for the second round insert PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sequenced PCR products showing overlapping peaks in their chromatograms were cloned using NEB PCR cloning kit (NEB #E1202S) and then sequenced to define the identity of mutations carried by F1 heterozygous animals ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were prepared using the NEBNext® Ultra™ II FS DNA Library Preparation Kit (New England Biolabs) and the Unique Dual Indexing Kit (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were prepared using the NEBNext Ultra DNA Library Prep kit for Illumina (New England BioLabs, United States) according to manufacturer’s instructions ...