Labshake search
Citations for New England Biolabs :
451 - 500 of 700 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... or amino acid substitutions was carried out using the Q5 DNA polymerase and KLD enzyme mix (NEB). Plasmid DNA was extracted and purified from 5 ml or 250 ml bacterial culture using Miniprep (Qiagen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... nucleic acids were digested by addition of 10 µL of DNaseI (2000 units/mL, New England Biolabs) and CaCl2 to a final concentration of 10 mM ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA was subjected to two rounds of poly(A) selection using oligo-d(T)25 magnetic beads (New England Biolabs, CA, USA). Illumina compatible RNAseq library was prepared using NEB next ultra RNAseq library preparation kit ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Immunology 2023Quote: ... Read 1 and Read 2 sequencing primers (sequences listed in Table S2) were added PCR fragments by T/A ligation using NEBNext Ultra II Ligation Module (E7595, New England Biolabs, Ipswich, MA). Spacers and minimal promoter were added to sequencing primer-ligated enhancers using the primers 5BC-AG-f02 and 5BC-AG-r02 (Table S2) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... and then the fragment was subcloned to replace ∼0.7-kb PacI-AscI region of pFA6a-link-yoTagRFP-T-CaURA3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). To generate ...
-
bioRxiv - Cell Biology 2024Quote: ... A minimum of 75 µg of total RNA was used as starting material to purify poly(A) RNAs using Oligo d(T)25 Magnetic Beads (NEB, Cat # s1419S). 50 pmoles of linker (REL5 ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Genomics 2019Quote: ... DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2020Quote: ... The dried glycoproteins were incubated with trypsin for 16 h at 37°C before releasing N-glycans using PNGase F (New England Biolabs, MA). Liberated N-glycans were separated from glycopeptides by C18 Sep Pak SPE cartridges (Waters Corporation ...
-
bioRxiv - Cancer Biology 2020Quote: ALC1 cDNA was cloned into a retroviral pOZ-N vector as well as in a pMSCV-puromycin vector using Gibson Assembly (NEB, E5510S) with an N-terminus FLAG-HA tag ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was subjected to end repair and dA-tailing reaction using NEBNext End repair/dA-tailing module (NEB, cat. n°E7546S) following the manufacturer’s instruction and incubated for 5 min at 20°C and then 5 min at 65°C ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9-noTags was performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the mitochondrial glutamate dehydrogenase (mGDH ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated using a 12% SDS-PAGE and mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were prepared using the NEBNext Ultra II kit (New England Biolabs, cat. no. E7645S/L). Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs ...
-
bioRxiv - Systems Biology 2019Quote: ... Each of the four-nucleic acid substrates were radiolabeled with [γ-32P]-ATP using T4 Polynucleotide Kinase (NEB). Free nucleotide was removed using G-25 MicroSpin columns (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Molecular Biology 2022Quote: ... Removal of sialic acids was performed using the α2-3,6,8 neuraminidase (New England Biolabs, 50 U/μg protein). Removal of fucose was performed using α1-2,4,5,6 fucosidase O (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 nM okadaic acid (Enzo LifeSciences, ALX-350-011-M001) 50 U micrococcal nuclease (New England Biolabs, M0247S)) ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Molecular Biology 2023Quote: ... the pGL3 Basic vector and T/F LTR U3R PCR products were digested with KpnI and HindIII (New England Biolabs, Ipswich, MA, USA), individually as per manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: ... and peptides in one aliquot were deglycosylated by further treatment with 125 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA) for 16 h at 37 °C.
-
bioRxiv - Genomics 2020Quote: ... sticky ends were filled by incubating the nuclei for 4h at RT with DNA Polymerase I (New England Biolabs, Cat. N: M0210) and a biotin-14-dATP (Life Technologies ...
-
bioRxiv - Genomics 2019Quote: ... were used to PCR amplify both wild type and RRM3 Mt cDNA inserts for ligation into a pET28b vector containing an N-terminal 10xHis-SUMO tag using the Quick Ligation kit (NEB, Ipswich, MA). Plasmids containing the cDNA of interest were verified by Sanger sequencing prior to expression (Quintara Biosciences ...
-
bioRxiv - Systems Biology 2019Quote: ... The cDNA inserts were PCR-amplified using primers specific for either the N- or C-terminal libraries using Phusion DNA polymerase (New England Biolabs, Ipswich, MA). Amplicons were PCR-purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding Sd223-440 was PCR amplified and inserted into a pET28-derived vector providing an N-terminal His-HRV3C-Avi-tag by HiFi DNA Assembly Cloning (New England Biolabs, Ipswich, MA) according to the instructions of the manufacturer ...
-
bioRxiv - Biochemistry 2020Quote: ... was PCR amplified and inserted into a pET28-derived vector providing an N-terminal His-HRV3C-tag by HiFi DNA Assembly Cloning (New England Biolabs, Ipswich, MA) according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... the desired sequences pertaining to the truncated forms of the N protein were subcloned from the synthetic gene using polymerase chain reaction (Phusion polymerase, New England Biolabs, Hertfordshire, UK). All genes were cloned into the modified pet28 vector and gene sequences were confirmed by Sanger Sequencing.
-
bioRxiv - Microbiology 2020Quote: ... 25 μg of protein was precipitated from cell lysate as described in Methods and treated with peptide-N-glycosidase F (PNGase F; New England Biolabs, MT, USA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Genomic (g)DNA was extracted from muscle biopsies (from n=27 participants) and isolated using the Monarch kit for DNA isolation (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The 16S rRNA V4 region was amplified using the following primers 515f-Y: GTGYCAGCMGCCGCGGTA and 806r-N: GGACTACNVGGGTWTCTAAT and The Q5® high-fidelity DNA polymerase kit (New England BioLabs, UK). 2μl of extracted DNA was added to a PCR reaction mix prepared by mixing a final concentration of 1X Q5 reaction buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... µM GAT-7N primers (5′- GTG AGT GAT GGT TGA GGT AGT GTG GAG NNN NNN N) and 2 units/µl DeepVent® (exo-) DNA polymerase (New England Biolabs, M0259L) in the programmable thermal cycler for 11 cycles ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA of TET21-N cells (Control and 24 h doxycycline) was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs, Hitchin, UK), from which complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...