Labshake search
Citations for New England Biolabs :
451 - 500 of 10000+ citations for Epiandrosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... NEB 5-alpha F’Iq cells (New England Biolabs) were used as the recipient strain for all plasmid constructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of CKII kinase (New England Biolabs) and 2.5 μL λ phosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with RNA 5’ Pyrophosphohydrolase (NEB) according to the manufacturer’s instructions prior to RNA circularization ...
-
bioRxiv - Molecular Biology 2019Quote: ... and containing 5 mM each NTPs (NEB # N0466S). After incubation for 3 hours at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 nM M13mp18 ssDNA template strands (Bayou Biolabs) was mixed with 5-fold molar excess of DNA staple strands (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2021Quote: ... and RNAs were 5’dephosporylation by quickCIP (NEB). Input (sRNA ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 U of Taq Polymerase (NEB, M0267) and incubating the samples at 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50 μL final reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µL terminal transferase (TdT) (NEB, CN M0315L). The reaction was incubated at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... and 5’ end repair with T4 PNK (NEB). The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Escherichia coli NEB 5-a (New England Biolabs) was used for cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... Escherichia coli NEB- 5-alpha (New England Biolabs) was used for cloning and BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 20 μM Cas9 (New England BioLabs), and 5 μL of 40 μM transcribed dgRNAs ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl of T4 DNA ligase (NEB, #M0202L), and 4 µl of 200 ng/µl linker were added to the 260 μ l of digested chromatin and mixed thoroughly ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were incubated with: 5 units RNaseH1 (NEB) in RNaseH1 Buffer (50 mM Tris-HCl pH 8.3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 U of Antarctic phosphatase (NEB M0289S) then incubated at 37 °C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μl of quick ligase (NEB M2200L). To release the non-ligated strand of the adaptor ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of 5 µM RA3 adapter (NEB) was added to 5 µL RNA sample ...
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5′ phosphorylated with T4 Polynucleotide Kinase (NEB). The fragments were mixed with Golden Gate cloning adaptors (5′ adapter ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain NEB 5-alpha (New England Biolabs) (Table S5).
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 μl 5× Q5 Polymerase Buffer (NEB #M0491), 0.25 μl Q5 DNA Polymerase (NEB #M0491 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Excess adapters were digested using 5’-Deadenylase (NEB) and RecJf (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 4× Template Switching RT buffer (NEB), 1 µl of 75 μM T7-TSO (5’-/5Biosg/ACTCTAATACGACTCACTATAGGGAGAGGGCrGrGrG-3’) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U/μL T7 RNA polymerase (NEB, M0251L), 1 U/μL RNase inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... the 5-µl of Bst 2.0 (NEB, M0537S) enzyme mixture (1× isothermal buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
bioRxiv - Genomics 2024Quote: ... followed by 5′ cap repair with RppH (NEB) and 5′ hydroxyl repair with PNK (NEB) ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... and 5 U/μL Taq DNA polymerase (NEB) for incubation at 25°C for 60 min and heating at 68°C for 30 s and then at 75°C for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Genomics 2019Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...