Labshake search
Citations for New England Biolabs :
451 - 500 of 3644 citations for 6 1 FLUOROETHYL 4 1H PYRIMIDINONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ug from each cell line was digested with 25 units EcoRI (New England Biolabs) in 100 ul total volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250ng of genomic DNA was digested with the 4-base cutter MnlI (NEB, Ipswich, MA), overnight at 37°C according to manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
bioRxiv - Bioengineering 2023Quote: ... Frozen cell pellets were resuspended in 4 mL of IMAC buffer (NEB, Ipswich, MA, USA) on ice and dispersed using an ultrasonic disruptor (Sonics ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was performed on 10 μL of RNA using the ProtoScript II Reverse Transcriptase and Random Primer 6 (New England BioLabs, Ipswich, MA, USA) under the following thermal conditions ...
-
bioRxiv - Genomics 2023Quote: ... and chromatin was digested during 10 min at 37 °C with 6 Kunitz units of MNase (New England Biolabs, 200 Kunitz units/µl) per 1 million cells ...
-
bioRxiv - Genomics 2023Quote: ... 2-8 µg of HMW DNA was diluted in 1x CutSmart Buffer and 6 µl of Quick CIP enzyme (New England Biolabs, catalog no. M0508) was added followed by incubation of the reaction at 37°C for 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... The entire alh-6 genomic sequence (ATG to stop) was amplified by PCR and cloned in a linearized pMiniT 2.0 vector (NEB PCR Cloning Kit, Cat. #E1202S). Plasmid DNA was purified using the Zymo Research Zyppy Plasmid Miniprep kit (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Immunology 2022Quote: ... Equal amount of total RNA in a maximal volume of 6 µ L is used for cDNA synthesis using NEB PhotoScript® First Strand cDNA Synthesis Kit (Catalog # E6300L, NEB Inc, Ipswitch, MA) as instructed in the manufacturer standard protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: ... was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1 % agarose gel for 3.5 h at 100 V ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Molecular Biology 2023Quote: ... pull-down was performed with 100 μl pre-blocked (NETS buffer with 4 mg/ml BSA (NEB) and 2 mg/ml tRNA (SigmaAldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 4 h at 16°C using 10,000 units of T4 DNA ligase (NEB) in 1.2 mL of ligation buffer (120 μL of 10× T4 DNA ligase buffer ...