Labshake search
Citations for Illumina :
1 - 50 of 1781 citations for tert Butyl 2 chloro 5H pyrrolo 3 4 b pyridine 6 7H carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Microbiology 2024Quote: ... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2020Quote: ... B) Informatics benchmarking (‘Experiment 2’) in which a seawater virome was sequenced with short-reads (Illumina) and long-read sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... B provided by Illumina technical support ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Microbiology 2021Quote: ... 8) DC3000 − B (Illumina only), 9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: Tn5ME-B (Illumina FC-121-1031), 59-GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAG-39
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2021Quote: ... B and D (Illumina, San Diego, CA). With a final reaction volume of 50 μL ...
-
bioRxiv - Plant Biology 2024Quote: ... B (Illumina Inc., San Diego, California, USA) with the following modifications ...
-
bioRxiv - Plant Biology 2024Quote: ... B (Illumina Inc., San Diego, California, USA) with the following modifications ...
-
bioRxiv - Microbiology 2024Quote: ... B (Illumina Inc., San Diego, California, USA) with the following modifications ...
-
bioRxiv - Genomics 2022Quote: ... Libraries depleted of ribosomal RNA (figure 2 and 3A-B) were constructed with the TruSeq Total RNA with Ribo Zero plant Kit (Illumina, San Diego, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Cancer Biology 2024Quote: ... the libraries were sequenced on the NextSeq 500 using a Mid-output 150-cycle Kit in 2×50 configuration to generate 6-8 million read-pairs per sample (Illumina). FastQC were used to examine characteristics of the sequencing libraries ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Developmental Biology 2022Quote: ... 75bp single end sequencing was carried out on 4-6 libraries / genotype using Illumina NextSeq500 High output mode and v2.5 chemistry (Illumina Protocol 15046563 v02, Mar 2016) to collect >25M reads per sample.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... After 2-3 passages in complete DMEM with 10% FBS gDNA was extracted to confirm the genotype by Illumina amplicon sequencing and live cell microscopy was performed.
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Zoology 2020Quote: ... but with TruSeq DNA Single Indexes (Set B, Illumina), following the manufacturers’ instructions up till the adapter ligation step ...
-
bioRxiv - Cell Biology 2020Quote: ... and TruSeq RNA Single Indexes Set B (20020493, Illumina) according to standard Illumina library preparation procedure ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Microbiology 2023Quote: ... and TruSeq DNA Single Indexes Set A or B (Illumina), excluding the DNA fragmentation and clean-up of fragmented DNA steps ...
-
bioRxiv - Microbiology 2024Quote: ... using the Nextera XT Index Kit v2 Set B (Illumina). Samples were normalized and pooled together using a combination of the Qubit (Thermo ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...