Labshake search
Citations for Illumina :
651 - 700 of 1391 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 0.33 μL of the PCR product was then used for a second PCR reaction to attach the TruSeq UDI (Illumina) indexes ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The clonal phage was PCR amplified using a protocol described in “PCR Protocol and Illumina sequencing” and analyzed by Illumina sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... and the IDT for Illumina DNA/RNA UD Indexes (Set A, produced by: Integrated DNA Technologies, Coralville, Iowa, USA, sold by: Illumina, Inc., San Diego, California, USA). Tagmented DNA was amplified for 5 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were constructed from 300 ng (liver) or 200 ng (hypothalamus) total RNA (NEBNext Multiplex Small RNA library prep set for Illumina, New England Biolabs, NEB-E7560S) and the small RNA fraction was sequenced on the NextSeq 500 System (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... individual 100bp TruSeq DNA PCR-free libraries (Illumina) were sequenced with Illumina HiSeq 2500 high-throughput paired-end sequencing technology at the Lausanne Genomic Technologies Facility (GTF ...
-
bioRxiv - Cancer Biology 2020Quote: ... The resulting PCR products were sequenced by Illumina Hiseq 4000 and evaluated based on the known sgRNA targets sequence.
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation (Illumina Shotgun TruSeq DNA PCR-free) and Illumina sequencing on a HiSeq X platform with a 150bp PE read length was performed by Macrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Paired-end libraries (Illumina TruSeq DNA, PCR-free) were made according to the standard Illumina protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The final PCR products were sequenced by Illumina MiSeq PE300.
-
bioRxiv - Genetics 2020Quote: ... single worm PCR products were analyzed by Illumina sequencing using 2×250 bp pair-end run ...
-
bioRxiv - Biochemistry 2021Quote: ... in an Eco Real-Time PCR System (Illumina). The following thermal cycling profile was used ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCRs were pooled and sequenced by Illumina sequencing (Duke Center for Genomic and Computational Biology (GCB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-Free kit (Illumina, San Diego, California, USA) and pooled samples sequenced on the HiSeq4000 platform (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... following Sequencing Protocol provided by Addgene (“Broad Institute PCR of sgRNAs for Illumina sequencing”). Next-generation sequencing was performed from the Molecular Pathology Genomics Core of Children’s Hospital Los Angeles using Illumina HighSeq 2500.
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA template was PCR amplified (Illumina barcoding) for 12 cycles and size selected to 225–350 bp length ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Systems Biology 2019Quote: ... Resulting moieties were characterized by Sanger DNA sequencing using pMOD forward and reverse primers according to the manufacturer’s protocol (EZ-Tn5, epicentre-Illumina, #TNP10622). Each fragment was then subcloned into a specifically designed SNAP-Tag in vitro expression vector ...
-
bioRxiv - Molecular Biology 2019Quote: ... and using alternate primer concentrations with SuperScript IV were subsequently tagged by specific index sequences (Nextera XT DNA Library Preparation Kit, Illumina), pooled and sequenced on a MiSeq instrument ...
-
bioRxiv - Genomics 2020Quote: ... DNA was amplified by PCR using Nextera primers and libraries were sequenced using a Next-Seq 500/550 high output kit v2 75 cycles (Illumina).
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... a V3-V4 region of 16S rRNA gene was amplified using standard degenerate primers fused with sequencing adapters (see Illumina guide for 16S Metagenomic Sequencing Library Preparation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Edits were confirmed by sequencing after amplification using index primers based on the NexteraXT index kit V2 setA (#15052163, Illumina) and the high fidelity Taq polymerase Kapa (#KK2602 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were prepared for SORT-seq as previously described.23 Illumina sequencing libraries were then prepared with the TruSeq small RNA primers (Illumina) and sequenced single-end at 75 bp read length with 75.000 reads per cell on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... The primers Uni530F and Uni907R (Nunoura et al., 2012) containing Illumina TruSeq adapter sequences (Illumina Inc., San Diego, CA, USA) were used for PCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... library preparation was done following the CEL-Seq2 protocol [41] to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Cancer Biology 2019Quote: PCR products were taken through a round of AMPure XP bead clean-up to remove primers and sent to the Wellcome Trust Sanger Institute (Cambridge, UK) for sequencing by Illumina MiSeq 2×300bp paired end chemistry in multiplex generating ~100,000 reads per sample ...
-
bioRxiv - Genomics 2021Quote: ... and each sample was uniquely indexed using Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001). Indexed libraries were purified with Omega Mag-Bind Total Pure NGS Beads ...
-
bioRxiv - Genomics 2021Quote: The read sequences in FASTQ format were first trimmed by removing six bases from random primers of TruSeq DNA Methylation Kit (Illumina) and the last 50 bases of low-quality reads ...
-
bioRxiv - Systems Biology 2021Quote: ... All samples were stored in 2ml of TE buffer at −80°C for later sequencing of the V6-V8 hypervariable region of the 16S rRNA gene using the universal microbial primers from Illumina.
-
bioRxiv - Molecular Biology 2021Quote: ... was used to extract mRNA from 1 μg total RNA and NEB Ultra Library Preparation Kit for Illumina was used to prepare sequencing libraries with different indexing primers to enable pooling of up to 10 libraries per lane of 50 bp SE HiSeq 2000 Sequencer (Illumina) runs ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The index sequences were defined by the combination of primers with TruSeq HT index 1 (D 7xx) and TruSeq HT index 2 (D 5xx) (Illumina). Index PCR was performed using KAPA HiFi HS ReadyMix (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... The generated libraries were amplified using the KAPA HiFi Hotstart Ready Mix and Nextera Index Kit 1 (i7) and 2 (i5) primers (Illumina). Amplified libraries were purified using a 0.65x AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... 1 ng cDNA was converted to a sequencing library using the NexteraXT DNA Library Prep Kit and NexteraXT indexing primers (Illumina) with 10 additional cycles of PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... The second-round PCR was performed using primer pairs with 16 unique indices: D501-D508 and A501-A508 (forward) and D701-D712 and A701-A712 (reverse) (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... In the first round of PCR we used primers that align to Illumina Truseq Read 1 primer site located directly upstream of the barcode in the lentiviral backbone and a primer annealing downstream of the barcode containing an overhand with Illumina Truseq Read 2 sequence (see ‘Illumina barcode sequencing 1st round PCR primers’ in the Supplemental Table 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... library preparation was done following the CEL-Seq2 protocol [50] to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Microbiology 2022Quote: ... bacterial genomic DNA was used for amplification of the V4 hypervariable region with universal primers (U515F/806R) flanked by Illumina standard adapter sequences and the products were pooled for sequencing on the Illumina MiSeq platform ...
-
bioRxiv - Genomics 2022Quote: ... Primers were separated from the library using AMPure XP size selection prior to 50 bp paired-end sequencing (HiSeqv4, Illumina).
-
bioRxiv - Microbiology 2022Quote: ... followed by polymerase chain reaction with primers containing Illumina adapters to construct DNA libraries for paired-end sequencing on a NextSeq machine (Illumina).
-
bioRxiv - Microbiology 2023Quote: Amplification of the V4 region of the 16S rRNA gene was carried out in triplicates with primers containing illumina adapters (515F-Illumina 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG GTG CCA GCM GCC GCG GTA A-3’ and 806R-Illumina 5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGG ACT ACH VGG GTW TCT AAT-3’) ...
-
bioRxiv - Genomics 2022Quote: All samples (n=75) underwent 16S rRNA gene sequencing using 515F-806R primers on the MiSeq (Illumina, San Diego, USA) as previously described (Seaton et al. ...
-
bioRxiv - Microbiology 2023Quote: ... V3-V4 region of 16S rRNA was amplified using primer 341F and 805R and libraries were prepared using Nextera XT Index Kit v2 (Illumina). The libraries were sequenced on Illumina Mi-Seq instrument using Miseq Reagent Kit v3 (600 cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... UV-cleaved oligonucleotides from each spatially resolved ROI were aspirated and collected in a 96-well collection plate to perform library prep with Seq Code primers and sequenced on an NextSeq500 sequencer instrument (Illumina). Digital count conversion files (DCC ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Systems Biology 2023Quote: ... The NGS libraries were pooled and sequenced as single-read with the custom sequencing primer provided with the QuantSeq NGS library preparation kit with 100 cycles on a HiSeq2000 sequencer (Illumina).