Labshake search
Citations for Illumina :
351 - 400 of 1392 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... with IDT for Illumina UD Indexes (96x, Plate A, Set 1, Illumina). Library size selection was performed to remove fragments below 180 bp and above 700 bp using AMPure XP beads (Beckman coulter) ...
-
bioRxiv - Genomics 2021Quote: ... 37 μL of the products was diluted to 50 μL of standard Phusion polymerase reaction mix in GC buffer with 0.1 μM primer M1 (annealing to the Illumina PE1.0 primer) and one of indexing primers M2,3 ...
-
bioRxiv - Genomics 2022Quote: ‘Amplify cDNA’ COVIDSEQ™ PCR Master Mix 1 and 2 were formulated using either the V3 primer pools (provided in the COVIDSEQ™ Library Preparation kit) or an aliquot of the V4 primer pools manufactured by Illumina, Inc for direct comparison of all specimens.
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Cell Biology 2024Quote: ... The second-strand cDNA was synthesized by adding 100 μM primer (the specific sequence at the 5′ portion corresponds to the primer for sequencing on the Illumina flowcell), 10× Taq DNA Polymerase Buffer ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TruSeq RNA Single Indexes Set A and B (Illumina, # 20020492 and 20020493). Library qualities and sizes were checked with the TapeStation 4200 and then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems) ...
-
bioRxiv - Evolutionary Biology 2021Quote: High-density genome-wide SNP array data sets (Illumina® BovineHD 777K BeadChip) corresponding to a total of 605 animals were obtained from published studies (Bahbahani et al ...
-
bioRxiv - Systems Biology 2020Quote: ... 2.5 μL N70x (Nextera Index Kit v2 Set A, TG-131-2001, Illumina), 2.5 μL i50x (E7600S ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were double indexed using Set A-barcoded adapters (Illumina, San Diego, USA). In-house modifications on the standard library preparation were conducted following Conceicão-Neto et al ...
-
bioRxiv - Microbiology 2020Quote: ... sonnei genotyper using the discovery genome set as input (Illumina reads, fastq format), to confirm that the genotype and QRDR mutations reported by this implementation were correct ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Evolutionary Biology 2022Quote: ... in 20 µL reactions with 4µL Nextera Unique Dual Indexes Set A (Illumina). We then quantified libraries by Qubit (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... The 16S metagenomic sequencing was performed according to the procedure set by Illumina (San Diego ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Genomics 2023Quote: ... a set of recently de novo-assembled libraries (Illumina NovaSeq 150 bp PE), from needle tissue of six individuals from a single half-sib family from Shadow Lake 39 ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... A set of 96 Unique dual index barcodes (Illumina TruSeq UD Indexes, # 20022370) were utilized to barcode samples ...
-
bioRxiv - Genomics 2024Quote: ... using IDT for Illumina – Nextera DNA UD Indexes Sets A-D (Illumina, USA). Fragmentation times and amplification cycles were performed according to the ranges recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2019Quote: ... i7 Index Primer from the Nextera Index Kit (Illumina), Nextera Primer P5 and Tagmented cDNA-NT buffer mix (72°C for 3 min ...
-
bioRxiv - Genomics 2020Quote: ... and using custom sequencing primers and recipe from Illumina.
-
bioRxiv - Cancer Biology 2020Quote: ... and i7 Index Primer (Nextera XT Index Kit, Illumina). Unique i7 Indexes were used for each ICELL8® 3’ DE Chip ...
-
bioRxiv - Microbiology 2019Quote: ... The ligated fragments were amplified using indexed primers (Illumina) for 8-10 PCR cycles ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 µM each primer (Primer1 and Primer2 for Illumina), 0.3 mM dNTP ...
-
bioRxiv - Immunology 2021Quote: ... Nextera i5 and i7 dual-index library primers (Illumina), and the following PCR settings ...
-
bioRxiv - Genomics 2021Quote: ... and 1.5 ul reverse primer (Illumina TruSeq Read 1), 4 ul cDNA ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina), 23 μL water) ...
-
bioRxiv - Developmental Biology 2020Quote: ... initially with primers containing the adaptors (Universal adaptors; Illumina) and subsequently another 8-12 PCR cycles with the specific primers (Illumina Nextera XT index kit) ...
-
bioRxiv - Genomics 2020Quote: ... using the 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... ATAC-seq libraries were amplified with Nextera primers (Illumina) by PCR and purified with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Dual index primer-Multiplex Oligos (Cat# E7600S, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... The primers used for indexing were obtained from Illumina, and the libraries were quantified and QC was done using the KAPA Library Quantification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primer indices were used in the reaction from Illumina (Nextera index primers i7 and i5 ...
-
bioRxiv - Microbiology 2023Quote: ... Primers were bar-coded using TruSeq Index Adapters (Illumina), allowing the mixing of samples from different individuals when sequencing PCR products using NextSeq sequencers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... and Index primer i5 (Illumina, FC-131-2001/2002) was combined with 12.5μl of the tagmented amplicon DNA ...
-
bioRxiv - Physiology 2023Quote: ... The adaptors and sequencing primers were obtained from Illumina. The libraries were sequenced by Novogene using the NovaSeq 6000 (PE150 ...
-
bioRxiv - Genomics 2020Quote: ... We also provided it with VCF-formatted NA12878 truth-set small variants from Illumina Platinum Genomes ...
-
bioRxiv - Cancer Biology 2019Quote: We used TCGA data sets of gene expression data (Illumina Hiseq RNA sequencing data) for kidney renal clear cell carcinoma samples and patients’ clinical record (http://gdac.broadinstitute.org/) ...
-
bioRxiv - Microbiology 2019Quote: ... RNA libraries were prepared using TruSeq RNA Library Prep Kit v2 set A (Illumina), according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... in combination with TruSeq DNA Single Indexes Set A (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using the TruSeq®Stranded mRNA LT Set B kit (Illumina) and sequenced (2×100bp ...
-
bioRxiv - Genomics 2020Quote: ... Quality control parameters for each data set (forward and reverse reads for Illumina data) such as the number of total reads and the Q30 (before filtering ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were indexed using the IDT for Nextera Unique Dual Indexes Set C (Illumina). Then ...
-
bioRxiv - Systems Biology 2023Quote: ... and the N7 indices from the Nextera XT Index Kit v2 Set A (Illumina) as also described in the updated PETRI-seq protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and IDT® for Illumina® DNA/RNA UD Indexes Set D (Illumina #20042667). Concentrations of 1.8 × AMPure XP magnetic bead purified libraries were measured using Qubit™ 1× dsDNA High Sensitivity Assay Kit (Thermo #Q33231 ...
-
bioRxiv - Genomics 2023Quote: ... and IDT for Illumina RNA UD Indexes Set A Ligation (Illumina, Cat. No. 20040553) according to its standard protocol unless stated otherwise below ...
-
bioRxiv - Immunology 2023Quote: ... and Nextera XT Index Kit v2 Set A (Illumina, Cat. No. FC-131-2001). Sequencing was performed on an Illumina NextSeq 500 sequencer to generate 2 × 76 paired end reads using NextSeq 500/550 High Output kit v2.5 (150 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries were prepared with Nextera® XT index Kit v2 Set A (Illumina). Once prepared ...
-
bioRxiv - Developmental Biology 2019Quote: ... or 6 bp (Nextera Index Read 1 Primer/i7) additional base pairs to the 3’ ends of standard Nextera primer sequences [100] (Illumina Inc., San Diego, California). Although we have not confirmed this directly ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were generated with TruSeq small RNA primers (Illumina) and sequenced paired-end at 60 and 26 bp read length ...