Labshake search
Citations for Illumina :
701 - 750 of 1391 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... cDNA library preparation with oligo-dT primers following the Illumina TruSeq stranded mRNA sample preparation guide (Illumina, San Diego, CA), and sequencing procedure with Illumina HiSeq 3000 platform with 30-50x106 bp reading depth were previously described in detail 19 ...
-
bioRxiv - Bioengineering 2023Quote: ... primers were designed containing a universal linker sequence allowing amplicons for incorporation indexes and sequencing primers by Nextera XT Index kit (ILLUMINA); and 16S rRNA gene universal primers (Klindwoth2013) ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Immunology 2023Quote: ... and DNA amplicon products where generated using Ig-specific variable and constant gene primers.87 Samples were indexed (Nextera Index Kit, Illumina), purified ...
-
bioRxiv - Neuroscience 2023Quote: Bacterial 16S rRNA amplicons were generated at the University of Missouri Genomics Technology Core via amplification of the V4 hypervariable region of the 16S rRNA gene using dual-indexed universal primers (U515F/806R) flanked by Illumina standard adapter sequences and the following parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers) and paired-end sequenced (42 bp) on the NextSeq 500 platform (Illumina) in accordance with the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... bacterial 16S rRNA amplicons were built via amplification of the V4 region of the 16S rRNA gene using the U515F/806R primer pair39 and processed for paired-end sequencing by MiSeq (Illumina) as previously described11,39,40 ...
-
bioRxiv - Developmental Biology 2024Quote: ... library preparation was done following the CEL-Seq2 protocol43to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... AMPure beads (Beckman Coulter, A63880 were used to remove primer dimers and libraries were sequenced on a NextSeq 500 instrument (Illumina) to generate 75 bp single-end reads.
-
bioRxiv - Genomics 2024Quote: ... we used primers flanking both sgRNA scaffolds and sequenced on a 300-cycle sequencing kit (e.g. Illumina MS-102-2002). For subsequent library sequencing without quantification of deletion events ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Microbiology 2019Quote: ... Equal amount of first round purified PCR products were used as templates for the second round indexing PCR using Nextera XT Index kit (Illumina USA). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Microbiology 2019Quote: ... The remaining contigs were amplified by PCR from the plasmid preparations that followed two iterations of SpyCas9 selection (those used in PCRs for Illumina library construction). PCR primers (table S6 ...
-
bioRxiv - Genetics 2020Quote: ... ChIP-seq and ATAC-seq libraries were quantified by RT-qPCR with the KAPA Library Quantification Complete Kit (KAPA) prior to sequencing on the NextSeq platform (Illumina) with 39 bp paired-end reads ...
-
bioRxiv - Cell Biology 2021Quote: ... The libraries were quantified by RT-qPCR and sequenced in paired-end mode (2x75 bp) with NextSeq 500 (Illumina, CA).
-
bioRxiv - Genomics 2019Quote: ... RNA-seq libraries were prepared from 100 ng of total RNA (obtained as described above for RT-qPCR) using the TruSeq Stranded Total RNA LT Kit with Ribo-Zero H/M/R (all Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... the samples were subjected to library RT and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the samples were subjected to library RT and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR amplification (TruSeq Nano Library Preparation Kit, Illumina). Samples generated with PC v2.0 and panel v4 also had unique molecular identifier (UMI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 100 PCR samples were then sequenced by Illumina sequencing platform ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free) and sequencing was done on the C2RT Biomics platform of the Institut Pasteur (using short reads ...
-
bioRxiv - Molecular Biology 2019Quote: ... Clones were screened by PCR and Miseq sequencing (Illumina).
-
bioRxiv - Genetics 2021Quote: ... the TruSeq DNA PCR-Free Library Preparation kit (Illumina) was employed to make a six-strain library ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification followed Earth Microbiome Project recommendations (“16S Illumina Amplicon Protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were barcoded and sequenced utilizing MiSeq (Illumina) Nano kit v.2 as described in [84].
-
bioRxiv - Cancer Biology 2022Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [56] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genomics 2023Quote: ... (2022) (TruSeq DNA PCR-free libraries sequenced on Illumina NovaSeq6000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [82] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2024Quote: ... with the TruSeq PCR-free library prep kit (Illumina) and the Sci clone next-generation sequencing (NGS ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR-free TruSeq DNA (Illumina, San Diego, CA) was used to prepare a library ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Immunology 2021Quote: ... and 200 pg of material was used to generate final sequencing libraries with the NexteraXT kit and NexteraXT Indexing primers (Illumina, Inc) using 12 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2020Quote: ... The forward and reverse primers were designed to contain an Illumina® overhang adapter sequence (Illumina®; San Diego, CA, USA) in order to anneal them to primers containing the Illumina® adaptors plus the 8 bp identifier indices ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and 8.8 µl of paired i7 and i5 Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001) were added to each Tagmentation reaction ...
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.