Labshake search
Citations for Illumina :
501 - 550 of 1391 citations for hsa mir 320a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The MDA reactions were prepared using RepliPHI Phi29 DNA polymerase and Reagent set (Epicentre, Illumina, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed on an Eco Real-Time PCR system (Illumina) in triplicates using PerfeCTa SYBR Green FastMix (Quanta) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... raw sequence data were filtered for contaminants (E. coli, PhiX, Illumina adaptors or primers) and low quality reads using bowtie2_db (Langmead & Salzberg ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina, Cambridge, UK)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM reverse primer (Nextera/Illumina i7 adaptors (Illumina, Cambridge, UK)) and 25μl NEBNext® Ultra™ II Q5 Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM reverse primer (Nextera/Illumina i7 adaptors (Illumina, Cambridge, UK)) and 25μl NEBNext® Ultra™ II Q5 Master Mix (NEB ...
-
bioRxiv - Genetics 2020Quote: ... reverse transcription was performed with Reverse Transcription Primer (RTP) (Illumina sequence, ordered via IDT) and SuperScript IV Reverse Transcriptase (ThermoFisher #18090050) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Double-stranded cap-trapped cDNAs were amplified using a Nextera XT index primer (Illumina), then size selected at 200–400 bp using AMPure beads (BeckmanCoulter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina, Cambridge, UK)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of each primer tagged with Nextera XT adapter (Illumina, San Diego, USA) and 1ul of DNA template ...
-
bioRxiv - Genomics 2019Quote: ... Working under the assumption that Illumina primers have been validated as unbiased by Illumina, we tested all forward (iTru5 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were designed based upon sequences obtained from the sequenced transcriptome (Illumina) of D ...
-
bioRxiv - Developmental Biology 2023Quote: ... sequencing libraries were constructed by adding Illumina P5 and P7 primers (Illumina, Evry, France), as well as sample index via end repair ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Genetics 2023Quote: ... five forward and five reverse primers contain Nextera transposase adapter sequences (Illumina Document#1000000002694) “TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG” (read 1 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing library was constructed using the TruSeq™ Nano DNA LT Sample Prep Kit–Set A (Illumina, USA) and amplified using the TruSeq PE Cluster Kit (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... We used computer simulations of collision frequencies to define the complexity of the search set (number of Illumina barcodes) allowed for different edit distances and maximal false assignment percentages ...
-
bioRxiv - Genomics 2022Quote: ... Supernatant was removed and transposition reaction was set up with 25 μl TD (2x reaction buffer, Nextera Kit, Illumina), 2.5 μl TDE1 (Tn5 transposase ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA library and sequencing have been performed according to manufactureŕs protocol (NEBNext Small RNA library prep set for Illumina). Next generation sequencing was performed on HiSeq 2000 platform.
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Genetics 2019Quote: ... mRNA libraries were prepared using TruSeq® Stranded mRNA LT - Set A kit (Illumina, CA, USA RS-122-2101) following manufacturer’s instructions and linked to different adaptors to enable pooling ...
-
bioRxiv - Genomics 2022Quote: ... analysis of the genotyping data set was performed using Illumina’s Array Analysis Platform (IAAP) Command Line Interface (CLI) and GTCtoVCF pipeline (github.com/Illumina/GTCtoVCF) (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...
-
bioRxiv - Microbiology 2022Quote: ... IDT for Illumina Nextera DNA Unique Dual Indexes (Set A, now called IDT for Illumina DNA/RNA UD Indexes) (produced by ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitated DNA was ligated to adapter primers using the TruSeq ChIP library preparation kit (Illumina) and then sequenced using the Illumina HiSeq 2500 platform according to the manufacturer’s recommendations (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA libraries were constructed and amplified using random primers according to the manufacturer’s instructions (Illumina TruSeq RNA sample preparation guide v2 for Illumina paired-end multiplexed sequencing) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The unique combination of indexed primer and barcoded adapter allowed for demultiplexing first by Illumina index and then by barcode ...
-
bioRxiv - Plant Biology 2021Quote: ... using custom sequencing primer (Wendler et al. 2014) as given in manufacturers protocol (Illumina Inc).
-
bioRxiv - Synthetic Biology 2021Quote: ... 16S rRNA genes were amplified using the primers described below (Illumina Part #15044223 Rev. B) and sequenced using Sanger sequencing (Eton Biosciences ...
-
bioRxiv - Genomics 2020Quote: ... the library was amplified off the beads using Phusion polymerase and Nextera indexing primers (Illumina). AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Neuroscience 2023Quote: ... Indexing libraries using Nextera i5 and i7 indexed amplification primers (Illumina XT index kit, 15055290) occurred alongside library amplification with NEBNext High-Fidelity PCR Master Mix (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared by the Genomics unit of the CRG Core Facility (Centre for Genomic Regulation, Barcelona, Spain) with NEBNext ChIPseq Library Prep Reagent Set (ref. E6200S, Illumina) and 50bp sequencing reads were trimmed to remove Illumina adapters and low-quality ends using Trimmomatic (Bolger et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using the configuration 28-8-98 on a single-index-paired-end run ...
-
bioRxiv - Systems Biology 2019Quote: ... Set D: indices 37–48 (Illumina, RS-200-0048)) (TruSeq Small RNA Library Prep Kit Reference Guide (Illumina, 15004197 Rev.G)) ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were prepared using the Illumina TruSeq DNA Sample Preparation Kit v2-set A (Illumina Inc., San Diego, CA, USA) according to manufacture guidelines ...
-
bioRxiv - Genomics 2020Quote: The accuracy of variant detection by ONT sequencing was evaluated by comparison to the set of variants identified by Illumina sequencing in matched cases ...
-
bioRxiv - Cancer Biology 2020Quote: ... The samples were barcoded and pooled in sets of eight per run to generate paired 150-bp reads with NextSeq 550 Sequencing System (Illumina), generating 21.2 - 118.8 million reads per sample ...
-
bioRxiv - Genomics 2019Quote: ... cDNA libraries were constructed using Illumina TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Set B (Illumina) to deplete ribosomal RNA according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: A set of 196 strains was subjected to whole genome shotgun sequencing using 2×250 bp Illumina (Illumina, Inc., USA) paired-end reads by MicrobesNG (https://microbesng.uk/ ...
-
bioRxiv - Neuroscience 2022Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using 100 bp paired-end run at a depth of 65-100 million reads ...