Labshake search
Citations for Illumina :
201 - 250 of 1393 citations for hsa mir 222 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Locus specific PCR product was used for indexing PCR using KOD Hot Start DNA Polymerase and TruSeq i5 and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... genotyped by PCR (genotyping primer sequences are presented in Table S4) and confirmed by Sanger Sequencing (Quintara Bio) or MiSeq (Illumina). Southern Blot using a CITRINE probe was carried out to verify single integration for the reporter cell lines.
-
bioRxiv - Microbiology 2023Quote: ... Indices were added in a second PCR over 8 cycles with unique primer combinations using the Nextera XT Index Kit V2 (Illumina). The samples were pooled and cleaned using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2023Quote: ... 200 pg of purified WTA products from each pool were subjected for library construction with custom designed New-P5-SMART-PCR primer using the Nextera XT DNA library preparation kit (Illumina) following the detailed protocol provided by the manufacture ...
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina indexes were added by amplifying 1 ng DNA to a 50 μl PCR reaction using Kapa HS enzyme and unique dual indexing primers (Illumina) for 11 cycles (Denaturation 95°C 3min ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Genomics 2020Quote: ... we performed adapter ligation using remaining Illumina TruSeq Single DNA Indexes Set A and Set B (Illumina, San Diego, USA), and performed adapter enrichment using the remaining PCR Primer Cocktail from the Illumina TruSeq Nano DNA Library Prep kit ...
-
bioRxiv - Immunology 2021Quote: ... Peptides carried by the MCRs from sorted cells were amplified from cDNA by RT-PCR using the peptide flanking regions and sequenced on a miniSeq (Illumina). Sequences from the Illumina output files were trimmed ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR reactions were performed using the Thunderbird® SYBR qPCR mix (TOYOBO) and Eco Real-Time PCR System (Illumina). The PCR primers used are listed in Supplementary Table S8 ...
-
bioRxiv - Cell Biology 2020Quote: ... TruSeq RNA Single Indexes Set A (20020492, Illumina) and TruSeq RNA Single Indexes Set B (20020493 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and TruSeq RNA Single Indexes Set A (Illumina) kits ...
-
bioRxiv - Bioengineering 2019Quote: ... sequencing adaptors and unique dual barcodes combinations were attached to each library PCR amplicons using the Nextera XT Index Kit primers (index 1 N7XX and index 2 S5XX, Illumina, CA), and the amplicon size and concentration were confirmed using a Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Genomics 2022Quote: ... After purifying the Sample Tag PCR1 product indexing PCR was done following instructions of the MULTI-seq protocol where small RNA TrueSeq indexing primers (Illumina #15004197) were used for i7 and the Forward Primer from the BD WTA kit was used for i5.
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) as follows:
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were used for the libraries cloned into pRDA-052 or pRDA-550 are listed below:
-
bioRxiv - Genetics 2022Quote: ... and hMT-2_R (GGCAGGTCAATTTCACTGGT)] and the library preparation of the LR-PCR products of hMT1 and hMT2 primers was conducted using DNA Prep Tagmentation (Illumina Inc.). This approach allows the fragment size of the tagmented LR-PCR products to be evenly 300 bp ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Immunology 2023Quote: ... 2.5μl Nextera XT V2 i5 primer and 2.5μl Nextera XT V2 i7 primer (Illumina). NexteraXT V2 primers (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... including a whole-genome sequencing (WGS) data set of 1196 subjects in the VCF format and two SNP array data sets of 382 (Illumina HumanOmniExpress) and 1709 (Affymetrix GeneChip 6.0 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... sequence libraries were prepared for each sample using TruSeq Stranded mRNA Library Prep/TruSeq RNA Single Indexes Set A & Set B (Illumina, Inc.). For sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... barcoded primers flanked by Illumina sequencing adaptors (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers were trimmed from Illumina reads using custom scripts prior to QIIME2 processing ...
-
bioRxiv - Immunology 2022Quote: ... with random hexamer primers (Illumina). Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... with random hexamer primers (Illumina). Then the synthesized cDNA was subjected to end-repair ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Nextera index primers (Illumina). Paired-end 50-bp sequencing (50 million reads per sample ...
-
bioRxiv - Plant Biology 2022Quote: ... with random hexamer primers (Illumina). Then the synthesized cDNA was subjected to end-repair ...
-
bioRxiv - Plant Biology 2022Quote: ... with random hexamer primers (Illumina). The synthesized cDNA was then subjected to end-repair ...
-
bioRxiv - Microbiology 2022Quote: ... with random hexamer primers (Illumina). The second strand of cDNA was generated by incorporating deoxyuridine triphosphate (dUTP ...
-
bioRxiv - Microbiology 2023Quote: ... with random hexamer primers (Illumina). Then ...
-
bioRxiv - Synthetic Biology 2023Quote: ... barcoded primers flanked by Illumina sequencing adaptors were used to generate the amplicons after 15-20 cycles of PCR for sequencing (Table S6) ...
-
bioRxiv - Plant Biology 2023Quote: ... with random hexamer primers (Illumina). Next ...
-
bioRxiv - Genetics 2023Quote: ... with Index Primers from Illumina (IDT for Illumina DNA/RNA UD Indexes Set A (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... with random hexamer primers (Illumina). Then the synthesized cDNA was subjected to end-repair ...
-
bioRxiv - Biochemistry 2023Quote: ... with random hexamer primers (Illumina). Following Illumina’s library construction protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... Unique forward primer barcodes (Illumina) were used to amplify the V4 region of the 16S rRNA gene (515fB-806r ...
-
bioRxiv - Genomics 2021Quote: ... reporter cDNA was PCR amplified using a reporter specific forward primer and a reverse primer binding the anchor sequence of the oligo- dT primer (corresponding to the Illumina TruSeq Read 1 sequence):
-
bioRxiv - Microbiology 2022Quote: ... The same amount of the seven purified 3-cycle PCR products were further amplified using Platinum SuperFi II and the index primers from Nextera XT Index Kit v2 (Illumina cat. 15052163). The PCR products were purified using 1.8× beads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bacterial 16S rRNA gene V1-V2 region was amplified using 27F and 338R PCR primers and sequenced on a MiSeq (2×250 bp; Illumina, Hayward, CA). Bioinformatic processing and statistical analysis were performed in R software environment as described previously 62 ...
-
bioRxiv - Genetics 2023Quote: ... 10 ng of amplicon DNA from PCR reaction 1 was combined with 10 µL of Nextera adapter index primers (Illumina Cat#20027213) and 25 µL Kapa HiFi Hotstart ReadyMix ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... five microarray data sets that were quantified by Illumina beadchip were combined as the MIBC-ILLUMINA cohort ...
-
bioRxiv - Evolutionary Biology 2020Quote: The hybrid read set (both Illumina and ONT reads) for each isolate was assembled using Unicycler 0.4.0 (Wick et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TruSeq RNA Single Indexes Set A (Illumina, 20020492) were used to prepare two Scrambled and two Setd2 knockdown libraries from 900 ng of total RNA per library ...
-
bioRxiv - Zoology 2020Quote: ... but with TruSeq DNA Single Indexes (Set B, Illumina), following the manufacturers’ instructions up till the adapter ligation step ...
-
bioRxiv - Systems Biology 2019Quote: ... Set D: indices 37–48 (Illumina, RS-200-0048)) (TruSeq Small RNA Library Prep Kit Reference Guide (Illumina ...