Labshake search
Citations for Illumina :
301 - 350 of 10000+ citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Poly-A selected strand specific library construction and paired-end sequencing (2x 125 bp on a HiSeq 2500 using v4 chemistry; Illumina, San Diego, CA, USA) was performed at the VBCF NGS Unit (Vienna ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sequenced on two separate rapid-runs on HiSeq2500 (Illumina), generating 100bp paired-end reads ...
-
bioRxiv - Biophysics 2020Quote: ... These two read sets (the MiSeq and the HiSeq Illumina datasets) composed the data for gene assembly.
-
bioRxiv - Cancer Biology 2023Quote: ... Two indexed libraries were sequenced on a NextSeq 500 instrument (Illumina) using a custom sequencing primer (MAC-seq Read primer ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were indexed and sequenced over two lanes using HiSeq4000 (Illumina) with 75 bp paired end reads ...
-
bioRxiv - Microbiology 2019Quote: ... FastANI was run on all pairwise comparisons of MAGs that were initially assessed using checkM (82 hybrid, 44 Illumina-only) (Jain et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Developmental Biology 2023Quote: ... The pool (F0 samples) and the hybrid F1 sample were both sequenced on Illumina NextSeq500 (Illumina, San Diego, CA, USA) using a MID output kit and reading 2 x 150 bases ...
-
bioRxiv - Microbiology 2023Quote: ... EGA10 and EGA65 genomes were sequenced and hybrid assembled at SeqCenter using sequencing data from Illumina (NextSeq 2000, 2×151bp) and Oxford Nanopore platforms ...
-
bioRxiv - Genomics 2022Quote: ... were sent to BGI-Shenzhen (Shenzhen, China) for library construction and sequencing on the using Illumina Genome Analyzer IIx (GAIIx) platform (Illumina Inc., San Diego, CA, USA) to generate single-end reads.
-
bioRxiv - Genomics 2022Quote: ... The DNA sample was sent to BGI Shenzhen (Shenzhen, China) for library construction and de novo sequencing on the Illumina HiSeq2000 and HiSeq2500 platform (Illumina Inc., San Diego, CA, USA) and the PacBio RS II platform (PacBio Inc. ...
-
bioRxiv - Pathology 2019Quote: ... A cBot Cluster Generation System using HiSeq PE Cluster Kit cBot-HS (Illumina) was used to cluster the index-coded samples ...
-
bioRxiv - Neuroscience 2020Quote: ... Library sequencing was multiplexed on two lanes of a HiSeq 2000 (Illumina) with 40 bp reads.
-
bioRxiv - Neuroscience 2022Quote: ... Libraries from two independent repeats were sequenced on a HiSeq 4000 (Illumina). After demultiplexing ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 20–30 sublibraries were sequenced on two lanes of a HiSeq4000 (Illumina) (spiked with 25% PhiX) ...
-
bioRxiv - Neuroscience 2021Quote: ... pool was quantified and sequenced using two NovaSeq 6000 S2 (Illumina, 20012861) runs on Illumina NovaSeq 6000 System (Illumina 20012850 ...
-
bioRxiv - Genomics 2019Quote: ... and with short reads using Pilon (two runs; Illumina library; Figure 1h).
-
bioRxiv - Microbiology 2022Quote: A two-step amplification protocol similar to the published Illumina protocol (Illumina 16S Metagenomic Sequencing Library Preparation) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pooled libraries were sequenced on two flowcells of a NextSeq500 instrument (Illumina) in 1×75bp single-end sequencing mode ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sequencing pool was adjusted to a final concentration of 11.5 pM (for V2 kits) or 18 pM (for V3 kits) and sequenced in a MiSeq system (Illumina, USA), using the standard Illumina primers provided by the manufacturer kit ...
-
bioRxiv - Microbiology 2020Quote: ... The libraries pools were adjusted to a final concentration of 11.5 pM (for V2 kits) or 18 pM (for V3 kits) and sequenced in a MiSeq system (Illumina, USA), using the standard Illumina primers provided in the manufacturer kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... mixed equimolarly and sequenced on a MiSeq system using a reagent kit v2 (Illumina). Sequencing data were processed with the MOIRAI workflow system (Hasegawa et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the kit used was IQ2 Fast qPCR System and the instrument was from Illumina Inc ...
-
bioRxiv - Microbiology 2023Quote: ... and then sequenced on a NextSeq550 system using High output 75 cycle kits (Illumina) at an average of 20,000 reads per cell ...
-
bioRxiv - Genomics 2021Quote: ... 1 μg of DNA-free total RNA was subjected to sRNA library construction according to manufacturer’s protocol (Illumina, cat. No. RS-200-0012 and RS-200-0024).
-
bioRxiv - Developmental Biology 2021Quote: ... The chromatin was then tagmented for two minutes with the Tn5 transposase (Illumina). Tagmented chromatin was eluted ...
-
bioRxiv - Plant Biology 2021Quote: ... The two RNA pools were sequenced using a HiSeq X instrument (Illumina, USA). The RNA-seq data were deposited in the NCBI Sequence Read Archive database (accession number PRJNA656212 ...
-
bioRxiv - Microbiology 2020Quote: ... and amoA was carried out in two steps using Nextera index adapters (Illumina). Primers nxrB169F and nxrB638R (Pester ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were constructed by pooling two immunoprecipitation (IP) samples using TruSeq adapters (Illumina) according to the TruSeq Illumina ChIP-seq sample preparation protocol with minor modification as described previously16 ...
-
bioRxiv - Genomics 2020Quote: ... Samples were genotyped using two different Illumina microarrays (Illumina, San Diego, CA, USA). One subsample (HeiDE1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries for two independent biological replicates were sequenced using a NextSeq 500 (Illumina) to obtain 79 + 79 nt ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced on two lanes of HiSeq 4000 (Illumina ®) at the OIST sequencing center.
-
bioRxiv - Microbiology 2022Quote: ... 150 bp reads were generated with two lanes of the NovaSeq platform (Illumina), to an average depth of 7 gbp per library ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries from two independent repeats were sequenced on a NextSeq 2000 P3 (Illumina). After demultiplexing ...
-
bioRxiv - Genomics 2023Quote: ... Tissue-specific libraries were sequenced PE150 on two lanes of NovaSeq 6000 (Illumina) (table S1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were sequenced on two Illumina HiSeq2500 lanes (Illumina; San Diego, CA, USA) using 100 bp paired-end reads at a depth of ∼30 million reads/sample and concurrently run with the PhiX quality control library (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... we fitted the coverage data along the chromosomes at two timepoints (first Illumina sequencing and second nanopore sequencing ...
-
bioRxiv - Genomics 2023Quote: ... 0.2 (Huang & Li, 2023) was run on all three final assemblies (i.e., MinION data, MinION data polished with Illumina data, and hybrid) generated for each species ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired-end sequencing was performed by HiSeq2000 sequencing system using a NextSeq 500/550 High Output kit (150 cycles) (Illumina Systems, San Diego, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... and sequenced using the NovaSeq 6000 S2 system and reagent kits (100 cycles) (Illumina, Inc).
-
bioRxiv - Plant Biology 2022Quote: ... After cluster generation on a cBot cluster generation system using Truseq PE Cluster kit (Illumina), the prepared libraries were sequenced on Illumina Nova ...
-
bioRxiv - Neuroscience 2023Quote: ... Clustering was done using cBot Cluster System using PE Cluster Kit cBot-HS (Illumina, USA) according to the manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequencing was performed using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit (cat# 20024906) on an Illumina Sequencing NextSeq 550 System ([RRID: SCR_016381], Illumina, San Diego, CA, USA). The initial annotated dataset went through quality control (QC ...
-
bioRxiv - Cancer Biology 2020Quote: ... The two independent libraries were combined and sequenced on a MiSeq/NextSeq instrument (Illumina) by paired-end sequencing (2×121 bp ...
-
bioRxiv - Genomics 2022Quote: Length of assembled heavy fibroin (HFib) gene with two approaches (HiFi, top; Illumina, bottom) for P ...
-
bioRxiv - Genomics 2019Quote: ... with default settings from Illumina HiSeq 50x (downsampled to two flow cells) 2×150 bp data and from Illumina HiSeq 45x 2×250 bp data for the AJ trio ...
-
bioRxiv - Microbiology 2019Quote: Aliquots of the same DNA extract were sequenced by two methods: short-read (Illumina), and long-read (Pacific BioSciences) ...
-
bioRxiv - Genomics 2021Quote: ... HTO and GDO libraries with two NextSeq 500 1×75 high-output runs (Illumina).
-
bioRxiv - Genomics 2020Quote: Assembly of the giant sequoia genome involved two major steps: contig assembly from Illumina and Oxford Nanopore reads and scaffolding with Chicago and Hi-C data by Dovetail Genomics ...