Labshake search
Citations for Illumina :
401 - 450 of 1014 citations for Tick Borne Encephalitis Virus Envelope Protein Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Tagmentation and amplification was performed using Nextera XT DNA Library Preparation Kit (Illumina, cat #FC-131-1096) and 600 pg input of each sample ...
-
bioRxiv - Immunology 2022Quote: ... RNAseq libraries were prepared with the Nextera XT DNA Library Preparation Kit (cat# FC-131–1096, Illumina) and carrying out 8 PCR cycles ...
-
bioRxiv - Microbiology 2022Quote: ... We then used an adaptation of the Nextera Library Prep kit (Illumina, cat. FC-121-1030/1031) (73 ...
-
bioRxiv - Microbiology 2022Quote: ... The library was prepared using Nextera XT DNA Library Preparation kit (Lot No. FC-131-1096, Illumina) and sequencing was performed on an Illumina Novoseq 6000 platform.
-
bioRxiv - Neuroscience 2022Quote: ... and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina, FC-401-4003) on a HiSeq 2500 system ...
-
bioRxiv - Neuroscience 2023Quote: ... Pellets were resuspended in transposase reaction mix (25 μL 2x TD Buffer (Illumina Cat #FC-121-1030) 2.5 μL Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Add (batch-determined actitivty) 2 to 2.5 uL of Nextera Tn5 transposase (Cat# FC-121-1030, Illumina. Samples were incubated at 37C for 30 minutes in a thermomixer at 500 RPM shaking ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The pellets were resuspended in the reaction buffer (25 μL TD Buffer (Illumina Cat #FC-121-1030), 2.5 μL Tn5 Transposes (Illumina Cat #FC-121-1030) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The quantified library pool was diluted to 1 nM and sequenced on MiniSeq (Illumina, FC-420-1001) to check for the quality of reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 25 μl of 2x TD buffer and 2.5 μl tagmentation enzyme (Illumina transposase FC-121-1030). DNA was purified using a Qiagen mini elute kit following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... which was performed using the Nextera XT library preparation kit (Illumina, FC-131-1096, San Diego, California) and then subsequent sequencing on the NovaSeq 6000 platform (1 x 100bp ...
-
bioRxiv - Bioengineering 2023Quote: ... The library was prepared using Nextera XT DNA library preparation kit (Illumina, cat no. FC-131-1096). For each setting ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) and sequenced by Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were resuspended in 50 µl transposition reaction mix with Nextera Tn5 Transposase (Illumina, FC-121-1030) and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pellet of nuclei was subjected to transposition with Nextera Tn5 transposase (Illumina #FC-121–1030) for 30 min at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... The nuclei were resuspended in transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121–1030, Nextera), 2.5 µl Tn5 Transposase (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody tag libraries were sequenced with an Illumina NextSeq 550 75-cycle High Output Kit (Illumina, cat. no. 20024906) in paired-end mode ...
-
bioRxiv - Microbiology 2023Quote: Raw FASTQ files provided by the GTF containing all reads and corresponding tags indicating whether they were accepted or filtered out according to the CASAVA 1.82 pipeline (Illumina). Only reads tagged as accepted were kept for further analysis ...
-
bioRxiv - Developmental Biology 2023Quote: 6hpf and 12hpf H2A.Z and Anp32e genomic localization data were collected using Epicypher CUT&Tag protocol and library generation followed by Illumina paired-end sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Genomics 2020Quote: ATAC-seq was performed as previously described using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030). First ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were then transposed for 30’ at 37’C with adapter-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and sequenced on an Illumina NextSeq 500 to generate 2x 75bp paired-end reads.
-
bioRxiv - Evolutionary Biology 2020Quote: ... from 1 μg DNA using the TruSeq PCRfree DNA sample preparation kit (FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350 bp as directed ...
-
bioRxiv - Neuroscience 2019Quote: ATAC-seq libraries were prepared using the Tn5 transposase system (Nextera DNA library kit, Illumina, FC-121–1030) as previously described (23) ...
-
bioRxiv - Bioengineering 2021Quote: ... 570 μL of denatured library DNA and 30 μL of denatured PhiX control library (Illumina, FC-110-3001) were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were then transposed for 30 min at 37C with adaptor-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and Sequenced on an Illumina NextSeq 500 platform to generate 2 x 36-bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...
-
bioRxiv - Physiology 2022Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Plant Biology 2021Quote: ... the Tn5 reaction was prepared and mixed well with nuclei using the Nextera reagents (Illumina, FC-121-1030) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... The full-length cDNA output was processed with Nextera XT DNA library preparation kit (Illumina #FC-131-1024) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Genomics 2019Quote: ... equivalent to the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001). Center-specific details are available from the TOPMed website82 ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tagmentation and library preparation was performed using the Nextera XT DNA Library Preparation Kit (Illumina, Cat# FC-131) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries for whole genome sequencing were prepared with Nextera DNA Library Prep Kit (FC-121-1031, Illumina). Libraries for RADseq were prepared according to the procedures of Adapterama III74 with few modifications ...
-
bioRxiv - Genetics 2021Quote: ... and Illumina libraries were prepared with different indexes using Nextera XT Library Prep Kit (Illumina, FC-131-1096). Prior to sequencing ...
-
bioRxiv - Physiology 2021Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Unique Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately 50.000 nuclei were used for the transposition reaction using hyperactive Tn5 transposase (Illumina Cat #FC-121-1030) followed by 13 cycles of PCR amplification ...
-
bioRxiv - Immunology 2020Quote: ... the sequencing library was then created from cDNA using the Illumina Nextera XT method (Illumina FC-131-1096). All libraries were combined and sequenced on Illumina HiSeq4000 lanes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were then resuspended in transposase reaction mix for 30 min at 37 °C (Illumina, Fc-121-1030). The samples were purified using Qiagen MiniElute kit (QIAGEN ...