Labshake search
Citations for Illumina :
501 - 550 of 790 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Single-cell RNA-sequencing libraries of the cDNA were prepared using the Nextera XT DNA library prep kit (Illumina). Libraries were multiplexed and sequenced in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were prepared using a Chromium Single Cell 3’ Library & Gel Bead kit v2 (10x Genomics, PN-120237) and sequenced using a NextSeq 500 (Illumina). The mean number of reads per cell was approximately 25,000 and the median number of genes detected per cell was approximately 2,000.
-
bioRxiv - Microbiology 2020Quote: ... The samples were clustered on a flow cell and 50 cycle paired-end sequencing was performed on an Illumina HiSeq 2000 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... 75-bp single-end sequencing was performed on 12 multiplexed libraries pooled together in one flow cell using a NextSeq 500 high output sequencer (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Totally 3 μg of total RNA was ligated with 5′- and a 3′-adaptors sequentially with TruSeqTM Small RNA (or Stranded Total RNA in the case of cancer cells) Sample Prep Kit (Illumina). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Indexed sequencing libraries were constructed using the Chromium Single-Cell 3’ library kit (10X Genomics) and sequenced on NovaSeq 6000 (Illumina) with the following parameters ...
-
bioRxiv - Immunology 2021Quote: ... Peptides carried by the MCRs from sorted cells were amplified from cDNA by RT-PCR using the peptide flanking regions and sequenced on a miniSeq (Illumina). Sequences from the Illumina output files were trimmed ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were generated using Kapa Biosystems library preparation kit (#KK8201) and multiplexed libraries were sequenced on a 1×75 High output flow cell on the NextSeq550 platform (Illumina). Reads were filtered and trimmed to remove adapter-derived or low-quality bases using Trimmomatic and checked again with FASTQC ...
-
bioRxiv - Developmental Biology 2021Quote: ... Chromium Single Cell 3’ v2 single cell RNA-Seq of poly A selected mRNA kit (10X Genomics) and Sequencing was processed on NextSeq 500 (Illumina). Bioinformatics base call by bcl2fastq v ...
-
bioRxiv - Immunology 2019Quote: VH and VL libraries from sorted B cell were subjected to NGS on the MiSeq platform with the reagent kit V3 2×300 bp paired-end (Illumina), using an input concentration of 16pM with 5% PhiX.
-
bioRxiv - Developmental Biology 2022Quote: 25.000 FACS-sorted cells were collected and used for ATAC Library preparation using Tn5 Transposase from Nextera DNA Sample Preparation Kit (Illumina). The cell pellet was resuspended in 50 µl Lysis/Transposition reaction (12.5 µl THS-TD-Buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a paired-end library was constructed using Illumina DNA Prep (earlier known as Nextera DNA Flex Library Prep) and sequenced on NovaSeq 6000 (NovaSeq SP 150bp Paired-end Flow Cell, Illumina) at the Biomedical Sequencing Facility (BSF ...
-
bioRxiv - Microbiology 2020Quote: DNA extracted from the three cell lines was genotyped on the 220k semi-custom CanineHD array (Illumina, San Diego, CA). Genotype data were managed in PLINK 1.9 (www.cog-genomics.org/plink/1.9/ ...
-
bioRxiv - Immunology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... Sample demultiplexing and clonotype alignment was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2019Quote: ... The libraries were hybridized to the flow-cell using TruSeq Rapid Duo cBot Sample Loading Kit (Illumina, CT-403-2001), utilising the Illumina RR_TemplateHyb_FirstExt_VR method on the Illumina cBot ...
-
bioRxiv - Microbiology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2019Quote: ... 7 or up to 17 samples were multiplexed per lane and run on a 50bp single-end flow cell in a HiSeq2000 or HiSeq3000 sequencer (Illumina), respectively ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were constructed from the barcoded cDNAs (Translational Science Laboratory at the Medical University of South Carolina) and sequenced for approximately 300 million reads/sample on a NovaSeq S4 flow cell (Illumina) at the VANTAGE facility (Vanderbilt University Medical Center).
-
bioRxiv - Genomics 2019Quote: ... we pooled together the single cell or nucleus libraries from different methods with normalized molar concentrations and loaded them onto a HiSeq2500 (Illumina) in the 8-lane high output or 2-lane rapid run mode to minimize the potential sequencing variation ...
-
bioRxiv - Plant Biology 2019Quote: ... The sequencing was performed with 2 x 100 bp read length of the flow cell loaded on a HiSeq 2500 sequencing system (Illumina).
-
bioRxiv - Biochemistry 2019Quote: ... The two cDNA libraries from RNAs of Cfdp1-K1 or dvR2-4 cells were prepared using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Their sequences were obtained using NovaSeq 6000 S4 Reagent Kit by a Nova Sequencing system (S1 Appendix ...
-
bioRxiv - Genomics 2020Quote: The forward indexing primer sequence is - AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and the reverse indexing primer sequence is - CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (where the bolded regions are the p5 and p7 flow cell adapters and [i5] and [i7] refer to the index sequence codes used by Illumina). The qPCR step starts with an initial denaturing step at 95 °C for 5 min followed by 35 cycles of denaturation (20s at 98 °C) ...
-
bioRxiv - Bioengineering 2020Quote: ... The barcoded amplicon samples were then sent to the UCLA Technology Center for Genomics & Bioinformatics for multiplex sequencing with 2 x 300 paired-end configuration in a single-lane flow cell of MiSeq instrument (Illumina). Fastq paired-end raw data were filtered ...
-
bioRxiv - Genetics 2021Quote: We merged fastq files from the same library when sequenced on multiple flow cells and trimmed the adapters using sequences provided by Illumina with Cutadapt/1.1562 ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were single end (75bp) or pair-end sequenced at 36 bp by 36 bp on a Nextseq550 flow cell (Illumina).
-
bioRxiv - Systems Biology 2020Quote: ... The pools were clustered on a single read flow cell and sequenced for 50 cycles on a HiSeq 4000 sequencer (Illumina). CASAVA (v2.20 ...
-
bioRxiv - Neuroscience 2020Quote: ... single cell and/or nucleus libraries were run using paired-end sequencing with single indexing on the HiSeq 4000 platform (Illumina) by following manufacturer’s instructions (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were multiplexed on two high-output flow cells and sequenced (using 75 bp reads) on a NextSeq 500 device (Illumina). The mean ± standard deviation (SD ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Microbiology 2020Quote: ... A reference genome from strain QMA0248 was constructed using both long reads derived from a single Smrt Cell using the PacBio RS II system with P4C2 chemistry and short reads from Illumina HiSeq2000 derived from Nextera XT paired-end libraries as reported elsewhere (NCBI accession no ...
-
bioRxiv - Plant Biology 2020Quote: ... sequencing was performed with Illumina NovaSeq 6000 system using S4 flow cell with lane divider (Illumina, San Diego, CA, USA). Read length for the paired-end run was 2×151 bp ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was diluted to an average of 200 pg/µl and 100 pg cDNA from each cell and was tagmented using Nextera XT DNA Library Preparation Kit (Illumina). The tagmentation reaction was incubated at 55 °C for 8 min before removing Tn5 from the DNA by adding 0.5 µl NT buffer per well ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing was performed in paired-end mode with a SP flow cell (2 x 50 cycles) using NovaSeq 6000 sequencer (Illumina).
-
bioRxiv - Neuroscience 2021Quote: Six hundred pg cDNA from each plate of cells was used in a modified Nextera XT (Illumina, San Diego, CA) library preparation ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were diluted and pooled into NGS libraries in equimolar amounts and sequenced at 75bp single-read chemistry on an Illumina NS500 MO flow-cell on a Ilumina NextSeq 500 instrument (Illumina) by the Genomics core facility (GCF ...
-
bioRxiv - Neuroscience 2020Quote: ... The pooled exome libraries were distributed across four lanes on an S4 flow cell and sequenced using 150 base pair paired-end approach on a NovaSeq 6000 instrument (Illumina). All sequencing was performed on the Illumina NovaSeq 6000 platform by loading a pool samples to the equivalent loading of 24 samples per flowcell ...
-
bioRxiv - Cell Biology 2020Quote: ... In total 279 single-cell libraries were pooled together and sequenced single-end 50bp on a single lane of a HiSeq4000 (Illumina).
-
bioRxiv - Cell Biology 2021Quote: RNA isolated from colonic epithelial cells was prepared for next-generation sequencing using the stranded RNA library preparation kit with rRNA depletion (Illumina) and sequenced using an Illumina HiSeq 2500 with 100bp single reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 50,000 nuclei were purified from WT or Sun dKO cells and DNA was tagmented using the Nextera Library Prep Kit (Illumina). Tagmented DNA was purified using the Qiagen MinElute PCR Purification kit ...
-
bioRxiv - Genomics 2020Quote: We compiled 64 published and newly generated DNAm datasets of untreated primary cells with reliable information on passage numbers (all Illumina 450k Methylation BeadChip ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were loaded on individual flow cell lanes and sequenced at a depth of 400 million reads using a HiSeq X Ten platform (Illumina) at Macrogen (Seoul ...
-
bioRxiv - Cancer Biology 2022Quote: ... The final pool was loaded in one lane of an S2 flow cell using the NovaSeq XP protocol (Illumina Inc.) (Figure S3 ...
-
bioRxiv - Cell Biology 2022Quote: Low-pass whole-genome sequencing (∼7x) of the different Pfn1 knock-out clones and WT MC3T3 cells was performed on a HiSeq 4000 (Illumina) to obtain 100 bp paired-end reads ...
-
bioRxiv - Neuroscience 2022Quote: ... RNAseq libraries were sequenced on a Hiseq2500 and HISeq4000 on a 2×100 bp paired end (PE) flow cell (Illumina) at an average of 100M PE/sample.