Labshake search
Citations for Illumina :
401 - 450 of 9000 citations for SpectraDye Antibody Labeling Kit 550 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Illumina, San Diego, CA).
-
bioRxiv - Immunology 2023Quote: ... The 1.2 pM library was sequenced on the NextSeq using the NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles) (Illumina, cat. no: 20024905) at UCL genomics.
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were then pooled and sequenced with a NextSeq 500/550 Mid Output v2 kit (150 cycles) according to the manufacturer’s recommendation (Illumina, FC-404-2001). Pooled samples were run in triplicate for a minimum sequencing depth of 20 million reads per sample ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... insert size 550 nt) were constructed from 1.8-2 µg gDNA with the TruSeq DNA PCR-Free kit (Illumina, San Diego, CA) and sequenced on the Illumina HiSeq 2500 by the Genomics Core Facility at Pennsylvania State University ...
-
bioRxiv - Genomics 2020Quote: ... Illumina libraries were sequenced on a NextSeq 550 (SY-415-1002, Illumina) using the NextSeq High Output Kit (150 cycles ...
-
bioRxiv - Immunology 2019Quote: ... and sequenced using paired-end sequencing on a NextSeq 550 instrument (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced with PE34 sequencing on the NextSeq 500/550 sequencer (Illumina).
-
bioRxiv - Evolutionary Biology 2022Quote: ... We sequenced the capture product on MiSeq and NextSeq 550 platforms (Illumina) using the MiSeq Reagent Kit v3 (600 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... WGS was performed on NextSeq 500/550 or MiSeq platforms (Illumina Inc.), generating 150bp or 300bp paired-end reads respectively ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... Equal amounts of libraries were mixed and sequenced using NextSeq 550(Illumina). The quality control of the ribosome footprinting libraries is provided in the Figure S6.
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... The deep sequencing was performed on the NextSeq 550 sequencing system (Illumina) with a 75-cycle ...
-
bioRxiv - Plant Biology 2020Quote: ... Pooled libraries were sequenced in a NextSeq®550 sequencing platform (Illumina). Two biological replicates were generated for each genotype ...
-
bioRxiv - Developmental Biology 2022Quote: ... pooled and sequenced 36 bp pair-end on the NextSeq 550 (Illumina) using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Microbiology 2022Quote: Sequencing runs were performed on NextSeq 550 or NovaSeq 6000 platforms (Illumina) with a target of at least 10,000 reads/cell for ADT libraries and 25,000 reads/cell for ATAC libraries.
-
bioRxiv - Cell Biology 2022Quote: ... Library final concentration of 2nM was loaded on NextSeq 500/550 (Illumina) sequencing machine aiming at 20 M reads per sample with the following setting ...
-
bioRxiv - Developmental Biology 2022Quote: ... Small RNA-seq libraries samples were sequenced using a NextSeq 550 (Illumina) to obtain 79-nt ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were paired-end sequenced (38bp+38bp) on a NextSeq 550 (Illumina) or 61bp+61bp on Novaseq 6000 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... Libraries were paired-end sequenced (38bp+38bp) on a NextSeq 550 (Illumina) or 61bp+61bp on Novaseq 6000 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... and were paired-end sequenced (38bp+38bp) on a NextSeq 550 (Illumina) or 61bp+61bp on Novaseq 6000 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... Samples were sequenced 36 bp pair-end on the NextSeq 550 (Illumina) using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Genomics 2022Quote: ... pooled and sequenced 36 bp pair-end on the NextSeq 550 (Illumina) using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... and paired end sequencing was performed on the Nextseq 550 platform (Illumina). Sequenced reads (150 bp paired end ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequencing libraries were run on either a MiSeq or NextSeq 550 (Illumina) with 2x150 base paired-end reads.
-
bioRxiv - Genomics 2023Quote: ... The resulting library was sequenced on a NextSeq 550 Platform (Illumina Inc.) using a Mid Output Kit with the following cycles ...
-
bioRxiv - Genetics 2023Quote: ... The libraries were pooled and sequenced on a NextSeq 550 machine (Illumina) using a High Output Kit v2.5 (75 Cycles ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both types of arrays were scanned on a NextSeq 550 system (Illumina). HMW genomic DNA was sequenced to ∼30x coverage on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... Paired-end shotgun metagenome sequencing was performed on a NextSeq 550 (Illumina) sequencer using the NextSeq High Output Kit v2 sequencing reagent kit ...
-
bioRxiv - Microbiology 2022Quote: ... WGS was performed on an Illumina Nextseq 550 platform (Illumina, CA, USA). Quality of the FASTQ reads and trimming of low-quality residues was performed on Trimmomatic (Galaxy Version 0.38) ...
-
bioRxiv - Genomics 2023Quote: ... Pooled libraries were paired-end sequenced with a NextSeq 550 system (Illumina) using a high-output kit and 300 cycles and 20% of PhiX DNA spike-in ...
-
bioRxiv - Molecular Biology 2023Quote: ... and sequenced on a NextSeq 550 sequencer (Illumina, San Diego, CA, USA), generating 150bp paired-end data ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cell Biology 2023Quote: PCR amplicons were sequenced using a NextSeq 550 (Illumina, San Diego, CA) using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were pooled and sequenced (paired-end 2*75bp) on a NextSeq500 using the NextSeq 500/550 High Output Kit v2 according to the manufacturer’s instructions (Illumina, San Diego, CA, USA). Raw sequencing data generated by the Illumina NextSeq500 instrument were mapped to the mouse reference genome using the hisat2 software(Kim et al. ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing was undertaken at UCD Conway Institute of Biomolecular and Biomedical Research on an Illumina NextSeq 500/550 using the high output v2 (75 cycle) reagent kit (Illumina TG-160-2005).
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Developmental Biology 2022Quote: ... The barcoded libraries were then pooled at equimolar ratios and sequenced on a NextSeq500/550 instrument (Illumina, 150 cycles High Output kit v2.0) to generate 150-bp single-end reads ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing was undertaken at UCD Conway Institute of biomolecular and biomedical Research on an Illumina NextSeq 500/550 using the high output v2 (75 cycle) reagent kit (Illumina TG-160-2005). Further sequencing was performed on NovaSeq platforms.
-
bioRxiv - Genomics 2020Quote: ... Paired-end sequencing was performed on the Illumina NextSeq 500 platform using NextSeq 500/550 High Output kit (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2020Quote: ... The samples were sequenced on the NextSeq 550 platform using paired-end 2×75 bp Reagent Kit from Illumina (San Diego, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... University of Edinburgh using the NextSeq 500/550 High-Output v2 (150 cycle) Kit (# FC-404-2002) with a High Out v2.5 Flow Cell on the NextSeq 550 platform (Illumina Inc, #SY-415-1002). 8 libraries were combined in an equimolar pool based on the library quantification results and run across one High-Output Flow Cell ...
-
bioRxiv - Genomics 2022Quote: ... the purified pooled libraries at 1.5 pM were loaded onto an Illumina NextSeq 500/550 instrument with a Mid Output kit v2.5 (150 cycles) (Illumina, San Diego, CA, USA) using custom sequencing primers (both index and amplicon primers ...
-
bioRxiv - Neuroscience 2023Quote: ... Multiplex samples Pool (1.65 pM including PhiX 1%) was loaded in NextSeq 500/550 High Output v2 kit (75 cycles) cartridge (catalog #FC-404-1005; Illumina, San Diego, CA) and loaded on NextSeq 500 System machine (Illumina) ...
-
bioRxiv - Physiology 2023Quote: ... Each donor library pool was sequenced twice using the Illumina NextSeq500 with NextSeq 500/550 High Output v2 or v2.5 75-cycle kits (Illumina, USA; FC-404-2005). Libraries were sequenced using the following cycle parameters ...
-
bioRxiv - Neuroscience 2024Quote: ... Individually barcoded libraries were pooled and sequenced on a NextSeq mid-output paired-end sequencing run at 2×75 using NextSeq 500/550 Mid-Output v2.5 kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The denatured and diluted libraries were sequenced on a NextSeq 550 System (Illumina) using v2.5 High Output 300 cycle kit with 1% PhiX to an average sequencing depth of 50X coverage.
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... The libraries generated were then run on the NextSeq 550 Sequencing System (Illumina) using NextSeq 500/550 High Output v2.5 (150 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... These libraries were pooled and sequenced using a NextSeq 550 instrument (Illumina, USA) with a MidOutput cartridge at 2x75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were diluted to 1.8 pM for loading onto the NextSeq 550 (Illumina) with a 150-cycle paired-end kit using the following read length ...
-
bioRxiv - Genomics 2019Quote: ... paired-end (2×150bp) sequencing was performed on a NextSeq 550 system (Illumina) with 20 samples on one run in High Output mode ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing of 2×150 bp was performed with a NextSeq 550 sequencer (Illumina) at the sequencing core facility of the Faculty of Medicine (Leipzig University ...