Labshake search
Citations for Illumina :
1 - 50 of 656 citations for Solute Carrier Family 12 Member 1 SLC12A1 Antibody APC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... A genome-wide analysis genotyping scan was performed in all six members of family A and in the proband of family B using the HumanCytoSNP-12 DNA Analysis BeadChip Kit (Illumina, San Diego), according to manufacturer’s instruction ...
-
bioRxiv - Genetics 2024Quote: ... The IBD between long-lived family members was calculated using the --ibd module from Merlin using previously generated genome-wide genetic data from Illumina BeadChips 112,113 ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Microbiology 2020Quote: ... The number of exported cells was estimated on family-level by first multiplying 16S rRNA gene abundances per liter by the seepage volume collected at a given time point and by the relative abundance of a given family obtained from Illumina amplicon sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12 times 8 Nextera (Illumina) based primer combinations were used ...
-
bioRxiv - Systems Biology 2020Quote: ... Expression in cohort 1 was measured using HumanHT-12 v4 Expression Beadchip microarrays (Illumina, Inc.) with ∼44k probes ...
-
bioRxiv - Genomics 2022Quote: ... and 12% PhiX control library v3 (Illumina) was spiked into the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... of 34,363 (HT-12 v3 platform, Illumina_Human_WG-v3) probes representing 24,369 genes ...
-
bioRxiv - Cancer Biology 2021Quote: ... and gene expression (Illumina HumanHT-12 V4.0 expression beadchip) data from the Oslo cohort were obtained from the Gene Expression Omnibus (GSE68339) ...
-
bioRxiv - Immunology 2020Quote: ... Microarray was performed using the HumanHT-12 beadchip (Illumina, Inc. ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Systems Biology 2023Quote: ... we downloaded gene expression data (Illumina HT 12, EGAD00010000434) and miRNA expression data (Agilent ncRNA 60k ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a microarray-based technology (Illumina HT-12 arrays) (30 ...
-
bioRxiv - Microbiology 2024Quote: ... diluted to 12 pM with HT1 hybridization buffer (Illumina) and mixed with 40% PhiX Control v3 (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:15 and subsequently tagmented and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina FC-131). Individual libraries were QC’d by Qubit and Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2020Quote: ... We spiked 12 pM library with 1% PhiX control (PhiX Control v3) and sequenced on an Illumina MiSeq platform (Illumina, San Diego, USA) using a MiSeq Nano Reagent Kit v2 (500 cycles) ...
-
bioRxiv - Genomics 2022Quote: ... and diluted to 12 pM for sequencing on NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Gene expression data (cDNA microarray profiling, Illumina HT-12 v3 platform) from Molecular Taxonomy of BRCA International Consortium (METABRIC ...
-
bioRxiv - Cell Biology 2024Quote: ... cRNA samples hybridized to the Human HT-12 BeadChip array (Illumina) were scanned on the BeadArray Reader (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... previously obtained using a microarray-based technology (Illumina HT-12 arrays), and GSE221770 24 ...
-
bioRxiv - Genomics 2020Quote: ... We spiked in 1% PhiX control (PhiX Control v3) in a 12 pM library and sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA) using a MiSeq Nano Reagent Kit v2 (500 cycles).
-
bioRxiv - Cell Biology 2020Quote: ... and hybridized on Illumina whole-genome HumanHT-12 v 4.0 chip (Illumina). Acquisition and data analysis were performed as previously described14 ...
-
bioRxiv - Genomics 2020Quote: ... Fragments were amplified with 12–18 cycles using adaptor specific primers (Illumina); fragments ranging between 300 and 500⍰bp in size were gel-purified before cluster generation and sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Cancer Biology 2021Quote: ... and mRNA expression was determined with the HT-12 v4 chip (Illumina, San Diego ...
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Systems Biology 2023Quote: ... and hybridized to HumanHT-12 v4 BeadChip microarrays (Illumina, BD-901-1001) as described previously20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were hybridized to Human HT-12 V.4.0 BeadChip arrays (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The data was measured using the Illumina HT-12 v3 platform (Illumina_Human_WG-v3). This dataset included the mutation status of the TP53 gene ...
-
bioRxiv - Microbiology 2021Quote: ... 12-15 million sequence reads per sample were obtained on a HiSeq4000 (Illumina) with 150 bp read length.
-
bioRxiv - Genomics 2020Quote: ... cRNA samples were then hybridized to HumanHT-12 v3 Expression BeadChips (Illumina, Inc.).
-
bioRxiv - Pathology 2022Quote: ... The constructed 12 cDNA libraries were sequenced on Illumina HiSeqTM 4000 platform (Illumina). Raw data are available in NCBI Short Read Archive database (http://www.ncbi.nlm.nih.gov/sra/ ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: Genome integrity was assessed by the Infinium HumanCytoSNP-12 v2.1 BeadChip array (Illumina) using genomic DNA from iPSC lines (UCL Genomics) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using Illumina whole-genome expression array Human HT-12 V4 (Illumina, Saffron Walden, U.K.). Normalization of the quantified signals (background corrected ...
-
bioRxiv - Genomics 2020Quote: The sequencing-ready library (12 pM) was loaded onto a flow cell from Illumina MiSeq Reagent Kit v3 (150-cycle format ...
-
bioRxiv - Microbiology 2020Quote: ... This denatured library was diluted to 12 pM loading concentration with HT1 buffer (Illumina). PhiX control (20 pM ...
-
bioRxiv - Genomics 2022Quote: ... Both the HumanCytoSNP-12 BeadChip and the ImmunoChip platforms (Illumina, San Diego, CA, USA) were used to genotype the isolated DNA ...
-
bioRxiv - Genomics 2023Quote: ... and diluted to 12 pM for sequencing on the MiSeq and NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Genetics 2023Quote: ... Post-capture PCR was performed for 12 cycles and libraries were sequenced by Illumina HiSeq 2000 (paired-end 100bp).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Adapter extension was performed over 12 PCR cycles using TruSeq-compatible indexed primers (Illumina, Inc.) and Phusion high-fidelity taq polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... All 12 libraries were multiplexed into a single Illumina HiSeq 4000 (Illumina, Inc., CA, US) lane for 100 bp paired-end sequencing ...
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Genetics 2020Quote: Genotypes were generated using HumanCoreExome-12 v1.1 Illumina SNP arrays (Illumina, Inc., San Diego, CA), according to their manufacturer’s instructions and were called with the GenomeStudio Software provided by Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Samples were amplified for 12 cycles of PCR with TruSeq RNA CD Index Plate (Illumina) and pooled ...
-
bioRxiv - Molecular Biology 2021Quote: ... 12 cycles were used for Tn5 Nextera PCR amplification (Illumina Nextera DNA UD Indexes Kit). We aimed for 100M read pairs for each run on a HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Illumina HumanCore-12 Custom BeadChip and HumanCore-24 Custom BeadChip (Illumina, San Diego, CA), were used for the genotyping ...
-
bioRxiv - Cancer Biology 2023Quote: Previously published datasets generated with Illumina HumanHT 12 Expression BeadChips (Illumina, San Diego, CA, USA) or HTG EdgeSeq Oncology Biomarker Panel (HTG Molecular Diagnostics ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting cDNA was finally PCR-amplified (12 cycles) with TruSeq Dual Index sequencing primers (Illumina) and Herculase II Fusion DNA Polymerase (Agilent) ...