Labshake search
Citations for Illumina :
51 - 87 of 87 citations for Rubella Virus VLP strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... DNA from all strains was extracted and sequenced using an Illumina HiSeq 2500 device (Illumina, USA). The isolation and sequencing procedure is described in detail elsewhere [14] ...
-
bioRxiv - Genomics 2023Quote: ... 20 transformation cycles are performed consecutively and hybrid strains are whole genome sequenced (Illumina HiSeq, Eurofins) after cycle 10 and 20 ...
-
bioRxiv - Microbiology 2024Quote: ... and we used the genomes of all other strains analysed here that were previous assembled from Illumina data (Dumas et al ...
-
bioRxiv - Microbiology 2020Quote: ... At Gdansk two independent protocols were used for SARS-CoV-2 genome sequencing: Illumina RNA prep with enrichment for respiratory virus oligos panel V2 followed by Illumina MiniSeq medium output run that produced 150-nucleotide paired-end reads ...
-
bioRxiv - Immunology 2022Quote: Identity of virus stocks were confirmed by next-generation sequencing using a MiniSeq platform (Illumina, Inc; San Diego, CA, USA). RNA was purified from Trizol-inactivated material using a Direct-zol RNA Miniprep kit (Zymo Research ...
-
bioRxiv - Pathology 2020Quote: Library preparation for NHBE samples infected with influenza A virus (IAV) was performed using the TruSeq Stranded mRNA Library Prep Kit (Illumina) with Poly-A enrichment ...
-
bioRxiv - Microbiology 2022Quote: ... Passage 1 virus stocks were further produced in Vero TMPRSS2 cells and the presence of mutations was confirmed by Illumina sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were generated for three separate plants for each virus Libraries were sequenced (single-end, 75 nt) using an NextSeq 500 platform (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA of the strains CBC-1 and HTSH020 was sequenced in house on a MiSeq sequencer (Illumina) with 300 bp paired-end reads using PCR-free library preparation ...
-
bioRxiv - Microbiology 2021Quote: Whole-genome sequencing (WGS) of 31 EIEC strains used in a previous study (26) was performed by Illumina NextSeq (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... We sequenced at least one isolate of all strains across all study periods with both short-read (Illumina) and long-read (Oxford Nanopore ...
-
bioRxiv - Microbiology 2023Quote: We performed whole-genome sequencing (WGS) of the 158 barcoded strains used in our study (200 Mbp Illumina DNA sequencing ...
-
bioRxiv - Genetics 2024Quote: ... Primers were designed to amplify barcoded donor sequences on the plasmid pools to quantify strain abundance by Illumina sequencing with 2 × 150 bp reads (Novogene).
-
bioRxiv - Microbiology 2024Quote: ... mokuoloeensis strain HIMB1674 was sequenced (paired end, 2x151 bp) on a NextSeq 2000 (Illumina, San Diego, California, USA) from a library constructed using a modified Nextera XT library protocol42 and 7 ng of genomic DNA ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments of the SARS CoV-2 genome were hybridized with biotinylated respiratory virus oligos (Illumina Inc., San Diego, CA, USA). The DNA fragments hybridized with the custom oligos were captured using streptavidin magnetic beads ...
-
bioRxiv - Microbiology 2023Quote: The whole genome sequence of the mink-derived H5N1 clade 2.3.4.4b virus was determined using the Illumina MiSeq sequencing platform (Illumina, San Diego, CA, USA). Briefly ...
-
bioRxiv - Genetics 2019Quote: ... we established multivariable regression model (F(transformed age)) based on transformed age on the training sets from Illumina BeadChip (Supplemental Table S2) ...
-
bioRxiv - Immunology 2023Quote: ... and clustering were performed using the TruSeq RNA-Seq Sample Prep v2 Guide (Illumina, Part # 15026495 Rev F) using the Low Sample Protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the strains were previously subjected to whole-genome shotgun sequencing using 2×250bp Illumina paired-end reads (Illumina, USA). Genomes were assembled using SPAdes (v ...
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Those strains were chosen in order to genotypically match NSTI strains on the basis of micro-array-deduced clonal complexes (23) confirmed by whole genome sequencing (Illumina MiSeq technology ...
-
bioRxiv - Molecular Biology 2019Quote: ... Those strains were chosen in order to genotypically match NSTI strains on the basis of micro-array-deduced clonal complexes (23) confirmed by whole genome sequencing (Illumina MiSeq technology, Illumina, San Diego ...
-
bioRxiv - Microbiology 2021Quote: Pair-end libraries (2×150 bp) were prepared with 1 µg genomic DNA from the evolved strains and sequenced using a MiSeq sequencer (Illumina). The PALOMA pipeline ...
-
bioRxiv - Microbiology 2022Quote: ... Two clones that produce the Y113F substituted Gp8 were propagated twice on strains containing only pCas9-guide for further selection and genomes were sequence verified by Illumina sequencing as described below.
-
bioRxiv - Genomics 2019Quote: A set of 196 strains was subjected to whole genome shotgun sequencing using 2×250 bp Illumina (Illumina, Inc., USA) paired-end reads by MicrobesNG (https://microbesng.uk/ ...
-
bioRxiv - Microbiology 2020Quote: ... The pO157-cured and WT strains were whole genome sequenced from a paired-end library to generate short-read (Illumina) sequences (ENA accessible number ...
-
bioRxiv - Genomics 2019Quote: ... A whole genome library was created from strain CAI4-F2-Neut5L-NAT1-mCherry-GFP using Nextera-XT library construction strategy(Illumina) and sequenced on an Illumina MiSeq (150×150 paired end sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... pylori strains, were sequenced at either the University of Georgia Genomics Facility or Azenta Life Sciences (Chelmsford, MA, USA) by Illumina sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Library preparation of the modern strains was outsourced to Fasteris where classic TruSeq Nano DNA protocol following Nextera enzymatic DNA fragmentation was applied (Illumina). Sequencing for both historical and modern DNA was performed in a paired-end 2×150 cycles configuration on a NextSeq500 machine in several batches ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from Epstein–Barr-virus-transformed lymphoblastoid cell lines (LCLs) by following the Illumina TruSeq v2 RNA Sample Preparation protocol (Illumina, Inc., San Diego, CA) by the Department of Genetic Medicine and Development at the University of Geneva ...
-
bioRxiv - Microbiology 2021Quote: ... Whole-genome sequence determinations of strain CS1 were carried out with the PacBio (Pacific Biosciences, USA) and Illumina MiSeq (Illumina, USA) sequencing platform ...
-
bioRxiv - Genomics 2022Quote: ... sequencing was carried out on the Nichols reference strain using the Illumina NovaSeq 6000 platform following the manufacturer’s recommendations (Illumina, San Diego, CA). Sequencing of isolate CDC-SF003 and swab specimens were carried out using the MiSeq v2 (500 cycle ...
-
bioRxiv - Genomics 2021Quote: ... whole-genome of each strain was sequenced using Illumina NextSeq 2×150 bp after NextEra XT library preparation (Illumina, San Diego, CA) as in de Lastours et al ...
-
bioRxiv - Synthetic Biology 2021Quote: ... genomic library was prepared from four strains (B0, B1, B2 and B3) using the Nextera XT Library Preparation Kit (Illumina, San Diego, CA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Whole-genome sequencing for strains AKK101 and 3336 was performed by the Virginia Commonwealth University Genomics Core using the MiSeq platform (Illumina, San Diego, CA, USA) after the construction of a paired-end sequencing library using the Illumina Nextera XT DNA sample preparation kit (Illumina ...
-
bioRxiv - Epidemiology 2019Quote: ... pneumoniae isolates of the epidemic ST11-KL105 clone identified in 2006 (strain H642) and 2011 (H1523) was performed by Hi Seq 2000 Sequencing System (Illumina Inc., San Diego, CA, USA) (2 × 125 bp paired-ended reads ...