Labshake search
Citations for Illumina :
401 - 450 of 928 citations for Recombinant Mouse Mstn Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The quantified library pool was diluted to 1 nM and sequenced on MiniSeq (Illumina, FC-420-1001) to check for the quality of reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 25 μl of 2x TD buffer and 2.5 μl tagmentation enzyme (Illumina transposase FC-121-1030). DNA was purified using a Qiagen mini elute kit following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... which was performed using the Nextera XT library preparation kit (Illumina, FC-131-1096, San Diego, California) and then subsequent sequencing on the NovaSeq 6000 platform (1 x 100bp ...
-
bioRxiv - Bioengineering 2023Quote: ... The library was prepared using Nextera XT DNA library preparation kit (Illumina, cat no. FC-131-1096). For each setting ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) and sequenced by Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were resuspended in 50 µl transposition reaction mix with Nextera Tn5 Transposase (Illumina, FC-121-1030) and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pellet of nuclei was subjected to transposition with Nextera Tn5 transposase (Illumina #FC-121–1030) for 30 min at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... The nuclei were resuspended in transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121–1030, Nextera), 2.5 µl Tn5 Transposase (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Two μg of genomic DNA from each organism was subjected to indexed-tagged pair-end sequencing on an Illumina Hiseq 2000 platform (Illumina, CA, USA) to generate 100 bp paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample’s total DNA was fragmented and tagged with sequencing adapters using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA). As previously described ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Genomics 2020Quote: ATAC-seq was performed as previously described using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030). First ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were then transposed for 30’ at 37’C with adapter-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and sequenced on an Illumina NextSeq 500 to generate 2x 75bp paired-end reads.
-
bioRxiv - Evolutionary Biology 2020Quote: ... from 1 μg DNA using the TruSeq PCRfree DNA sample preparation kit (FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350 bp as directed ...
-
bioRxiv - Neuroscience 2019Quote: ATAC-seq libraries were prepared using the Tn5 transposase system (Nextera DNA library kit, Illumina, FC-121–1030) as previously described (23) ...
-
bioRxiv - Bioengineering 2021Quote: ... 570 μL of denatured library DNA and 30 μL of denatured PhiX control library (Illumina, FC-110-3001) were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were then transposed for 30 min at 37C with adaptor-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and Sequenced on an Illumina NextSeq 500 platform to generate 2 x 36-bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...
-
bioRxiv - Physiology 2022Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Plant Biology 2021Quote: ... the Tn5 reaction was prepared and mixed well with nuclei using the Nextera reagents (Illumina, FC-121-1030) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... The full-length cDNA output was processed with Nextera XT DNA library preparation kit (Illumina #FC-131-1024) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Genomics 2019Quote: ... equivalent to the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001). Center-specific details are available from the TOPMed website82 ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tagmentation and library preparation was performed using the Nextera XT DNA Library Preparation Kit (Illumina, Cat# FC-131) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries for whole genome sequencing were prepared with Nextera DNA Library Prep Kit (FC-121-1031, Illumina). Libraries for RADseq were prepared according to the procedures of Adapterama III74 with few modifications ...
-
bioRxiv - Genetics 2021Quote: ... and Illumina libraries were prepared with different indexes using Nextera XT Library Prep Kit (Illumina, FC-131-1096). Prior to sequencing ...
-
bioRxiv - Physiology 2021Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Unique Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately 50.000 nuclei were used for the transposition reaction using hyperactive Tn5 transposase (Illumina Cat #FC-121-1030) followed by 13 cycles of PCR amplification ...
-
bioRxiv - Immunology 2020Quote: ... the sequencing library was then created from cDNA using the Illumina Nextera XT method (Illumina FC-131-1096). All libraries were combined and sequenced on Illumina HiSeq4000 lanes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were then resuspended in transposase reaction mix for 30 min at 37 °C (Illumina, Fc-121-1030). The samples were purified using Qiagen MiniElute kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... we used 0.2ng of cDNA per cell and one-eighth of the Illumina NexteraXT (Illumina FC-131-1096) reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 minutes at 37°C with 1000 RPM mixing ...
-
bioRxiv - Cancer Biology 2022Quote: ... before being processed for Illumina sequencing via the Nextera XT DNA Library Preparation kit (Illumina; FC-131-1096). Sequencing was performed on an Illumina platform.
-
bioRxiv - Genomics 2022Quote: ... Nuclei pellets were resuspended in 50 μL transposition reaction containing 2.5 μL Tn5 transposase (FC-121-1030; Illumina). The reaction was incubated in a 37°C heat block for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Neuroscience 2022Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Combinatorial Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Microbiology 2023Quote: Adapter ligation and barcoding were performed using the Nextera XT Index Kit (#FC-131-1002, Illumina®, UK). PCR conditions involved 3 min of denaturation at 98°C ...
-
bioRxiv - Genomics 2023Quote: Next-generation sequencing libraries were prepared using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina). Following fluorometric quantification ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pooled amplicons were then sequenced on an Illumina MiniSeq system (300 cycles, Illumina sequencing kit #FC-420-1004) following the manufacturer’s protocol ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: Subsequent library preparation was performed according to manufacturer’s directions for the Nextera XT kit (Illumina, FC-131-1096) starting with 600 pg of cDNA and using a specific P5-Truseq PCR hybrid oligo in place of the Nextera XT i5 adapter (15ul Nextera PCR mix ...
-
bioRxiv - Genomics 2022Quote: ... 2.5 μL each of Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121—1011) and 10 μl of nuclease free H2O ...
-
bioRxiv - Genomics 2022Quote: ... To the 1.5 μl concentrated air DNA extraction we added 2.5 μl Illumina Nextera reaction buffer (FC-121-1030, Illumina), 1 μl 1 pg/μl Lambda DNA (SD0011 ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for ATAC samples were prepared using the Nextera DNA library preparation kit (Illumina, #FC-121-1030) according to the manufacturer’s instructions ...